DNASU Plasmid Repository • 480.965.5697 | Email

ITGB5 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ITGB5
Gene Name:  integrin, beta 5
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH015901.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00004487

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2400nts        
Open reading frame : 1 to 2400
Reference Sequence Alignment

ATGCCGCGGGCCCCGGCGCCGCTGTACGCCTGCCTCCTGGGGCTCTGCGCGCTCCTGCCC
CGGCTCGCAGGTCTCAACATATGCACTAGTGGAAGTGCCACCTCATGTGAAGAATGTCTG
CTAATCCACCCAAAATGTGCCTGGTGCTCCAAAGAGGACTTCGGAAGCCCACGGTCCATC
ACCTCTCGGTGTGATCTGAGGGCAAACCTTGTCAAAAATGGCTGTGGAGGTGAGATAGAG
AGCCCAGCCAGCAGCTTCCATGTCCTGAGGAGCCTGCCCCTCAGCAGCAAGGGTTCGGGC
TCTGCAGGCTGGGACGTCATTCAGATGACACCACAGGAGATTGCCGTGAACCTCCGGCCC
GGTGACAAGACCACCTTCCAGCTACAGGTTCGCCAGGTGGAGGACTATCCTGTGGACCTG
TACTACCTGATGGACCTCTCCCTGTCCATGAAGGATGACTTGGACAATATCCGGAGCCTG
GGCACCAAACTCGCGGAGGAGATGAGGAAGCTCACCAGCAACTTCCGGTTGGGATTTGGG
TCTTTTGTTGATAAGGACATCTCTCCTTTCTCCTACACGGCACCGAGGTACCAGACCAAT
CCGTGCATTGGTTACAAGTTGTTTCCAAATTGCGTCCCCTCCTTTGGGTTCCGCCATCTG
CTGCCTCTCACAGACAGAGTGGACAGCTTCAATGAGGAAGTTCGGAAACAGAGGGTGTCC
CGGAACCGAGATGCCCCTGAGGGGGGCTTTGATGCAGTACTCCAGGCAGCCGTCTGCAAG
GAGAAGATTGGCTGGCGAAAGGATGCACTGCATTTGCTGGTGTTCACAACAGATGATGTG
CCCCACATCGCATTGGATGGAAAATTGGGAGGCCTGGTGCAGCCACACGATGGCCAGTGC
CACCTGAACGAGGCCAACGAGTACACTGCATCCAACCAGATGGACTATCCATCCCTTGCC
TTGCTTGGAGAGAAATTGGCAGAGAACAACATCAACCTCATCTTTGCAGTGACAAAAAAC
CATTATATGCTGTACAAGAATTTTACAGCCCTGATACCTGGAACAACGGTGGAGATTTTA
GATGGAGACTCCAAAAATATTATTCAACTGATTATTAATGCATACAATAGTATCCGGTCT
AAAGTGGAGTTGTCAGTCTGGGATCAGCCTGAGGATCTTAATCTCTTCTTTACTGCTACC
TGCCAAGATGGGGTATCCTATCCTGGTCAGAGGAAGTGTGAGGGTCTGAAGATTGGGGAC
ACGGCATCTTTTGAAGTATCATTGGAGGCCCGAAGCTGTCCCAGCAGACACACGGAGCAT
GTGTTTGCCCTGCGGCCGGTGGGATTCCGGGACAGCCTGGAGGTGGGGGTCACCTACAAC
TGCACGTGCGGCTGCAGCGTGGGGCTGGAACCCAACAGTGCCAGGTGCAACGGGAGCGGG
ACCTATGTCTGCGGCCTGTGTGAGTGCAGCCCCGGCTACCTGGGCACCAGGTGCGAGTGC
CAGGATGGGGAGAACCAGAGCGTGTACCAGAACCTGTGCCGGGAGGCAGAGGGCAAGCCA
CTGTGCAGCGGGCGTGGGGACTGCAGCTGCAACCAGTGCTCCTGCTTCGAGAGCGAGTTC
GGCAAGATCTATGGGCCTTTCTGTGAGTGCGACAACTTCTCCTGTGCCAGGAACAAGGGA
GTCCTCTGCTCAGGCCATGGCGAGTGTCACTGCGGGGAATGCAAGTGCCATGCAGGTTAC
ATCGGGGACAACTGTAACTGCTCGACAGACATCAGCACATGCCGGGGCAGAGATGGCCAG
ATCTGCAGCGAGCGTGGGCACTGTCTCTGTGGGCAGTGCCAATGCACGGAGCCGGGGGCC
TTTGGGGAGATGTGTGAGAAGTGCCCCACCTGCCCGGATGCATGCAGCACCAAGAGAGAT
TGCGTCGAGTGCCTGCTGCTCCACTCTGGGAAACCTGACAACCAGACCTGCCACAGCCTA
TGCAGGGATGAGGTGATCACATGGGTGGACACCATCGTGAAAGATGACCAGGAGGCTGTG
CTATGTTTCTACAAAACCGCCAAGGACTGCGTCATGATGTTCACCTATGTGGAGCTCCCC
AGTGGGAAGTCCAACCTGACCGTCCTCAGGGAGCCAGAGTGTGGAAACACCCCCAACGCC
ATGACCATCCTCCTGGCTGTGGTCGGTAGCATCCTCCTTGTTGGGCTTGCACTCCTGGCT
ATCTGGAAGCTGCTTGTCACCATCCACGACCGGAGGGAGTTTGCAAAGTTTCAGAGCGAG
CGATCCAGGGCCCGCTATGAAATGGCTTCAAATCCATTATACAGAAAGCCTATCTCCACG
CACACTGTGGACTTCACCTTCAACAAGTTCAACAAATCCTACAATGGCACTGTGGACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2706
Start on reference sequence 307
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 9 42
recombination site loxP site loxP recombination site 1015 1048
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ITGB5
Symbol Nomenclature : ITGB5
Designation : integrin beta-5
Full Nomenclature : integrin, beta 5
GENEID : 3693
GI : 60653758
GenBank Accession : AY892656
HGNC : 6160
MIM : 147561
Vega : OTTHUMG00000159432
Target GenBank: BC006541

 

Reference Sequence Alignment

  

HsCD00004487        ATGCCGCGGGCCCCGGCGCCGCTGTACGCCTGCCTCCTGGGGCTCTGCGCGCTCCTGCCC
NM_002213.3         ATGCCGCGGGCCCCGGCGCCGCTGTACGCCTGCCTCCTGGGGCTCTGCGCGCTCCTGCCC
XM_005247436.1      ATGCCGCGGGCCCCGGCGCCGCTGTACGCCTGCCTCCTGGGGCTCTGCGCGCTCCTGCCC
                    ************************************************************

HsCD00004487        CGGCTCGCAGGTCTCAACATATGCACTAGTGGAAGTGCCACCTCATGTGAAGAATGTCTG
NM_002213.3         CGGCTCGCAGGTCTCAACATATGCACTAGTGGAAGTGCCACCTCATGTGAAGAATGTCTG
XM_005247436.1      CGGCTCGCAGGTCTCAACATATGCACTAGTGGAAGTGCCACCTCATGTGAAGAATGTCTG
                    ************************************************************

HsCD00004487        CTAATCCACCCAAAATGTGCCTGGTGCTCCAAAGAGGACTTCGGAAGCCCACGGTCCATC
NM_002213.3         CTAATCCACCCAAAATGTGCCTGGTGCTCCAAAGAGGACTTCGGAAGCCCACGGTCCATC
XM_005247436.1      CTAATCCACCCAAAATGTGCCTGGTGCTCCAAAGAGGACTTCGGAAGCCCACGGTCCATC
                    ************************************************************

HsCD00004487        ACCTCTCGGTGTGATCTGAGGGCAAACCTTGTCAAAAATGGCTGTGGAGGTGAGATAGAG
NM_002213.3         ACCTCTCGGTGTGATCTGAGGGCAAACCTTGTCAAAAATGGCTGTGGAGGTGAGATAGAG
XM_005247436.1      ACCTCTCGGTGTGATCTGAGGGCAAACCTTGTCAAAAATGGCTGTGGAGGTGAGATAGAG
                    ************************************************************

HsCD00004487        AGCCCAGCCAGCAGCTTCCATGTCCTGAGGAGCCTGCCCCTCAGCAGCAAGGGTTCGGGC
NM_002213.3         AGCCCAGCCAGCAGCTTCCATGTCCTGAGGAGCCTGCCCCTCAGCAGCAAGGGTTCGGGC
XM_005247436.1      AGCCCAGCCAGCAGCTTCCATGTCCTGAGGAGCCTGCCCCTCAGCAGCAAGGGTTCGGGC
                    ************************************************************

HsCD00004487        TCTGCAGGCTGGGACGTCATTCAGATGACACCACAGGAGATTGCCGTGAACCTCCGGCCC
NM_002213.3         TCTGCAGGCTGGGACGTCATTCAGATGACACCACAGGAGATTGCCGTGAACCTCCGGCCC
XM_005247436.1      TCTGCAGGCTGGGACGTCATTCAGATGACACCACAGGAGATTGCCGTGAACCTCCGGCCC
                    ************************************************************

HsCD00004487        GGTGACAAGACCACCTTCCAGCTACAGGTTCGCCAGGTGGAGGACTATCCTGTGGACCTG
NM_002213.3         GGTGACAAGACCACCTTCCAGCTACAGGTTCGCCAGGTGGAGGACTATCCTGTGGACCTG
XM_005247436.1      GGTGACAAGACCACCTTCCAGCTACAGGTTCGCCAGGTGGAGGACTATCCTGTGGACCTG
                    ************************************************************

HsCD00004487        TACTACCTGATGGACCTCTCCCTGTCCATGAAGGATGACTTGGACAATATCCGGAGCCTG
NM_002213.3         TACTACCTGATGGACCTCTCCCTGTCCATGAAGGATGACTTGGACAATATCCGGAGCCTG
XM_005247436.1      TACTACCTGATGGACCTCTCCCTGTCCATGAAGGATGACTTGGACAATATCCGGAGCCTG
                    ************************************************************

HsCD00004487        GGCACCAAACTCGCGGAGGAGATGAGGAAGCTCACCAGCAACTTCCGGTTGGGATTTGGG
NM_002213.3         GGCACCAAACTCGCGGAGGAGATGAGGAAGCTCACCAGCAACTTCCGGTTGGGATTTGGG
XM_005247436.1      GGCACCAAACTCGCGGAGGAGATGAGGAAGCTCACCAGCAACTTCCGGTTGGGATTTGGG
                    ************************************************************

HsCD00004487        TCTTTTGTTGATAAGGACATCTCTCCTTTCTCCTACACGGCACCGAGGTACCAGACCAAT
NM_002213.3         TCTTTTGTTGATAAGGACATCTCTCCTTTCTCCTACACGGCACCGAGGTACCAGACCAAT
XM_005247436.1      TCTTTTGTTGATAAGGACATCTCTCCTTTCTCCTACACGGCACCGAGGTACCAGACCAAT
                    ************************************************************

HsCD00004487        CCGTGCATTGGTTACAAGTTGTTTCCAAATTGCGTCCCCTCCTTTGGGTTCCGCCATCTG
NM_002213.3         CCGTGCATTGGTTACAAGTTGTTTCCAAATTGCGTCCCCTCCTTTGGGTTCCGCCATCTG
XM_005247436.1      CCGTGCATTGGTTACAAGTTGTTTCCAAATTGCGTCCCCTCCTTTGGGTTCCGCCATCTG
                    ************************************************************

HsCD00004487        CTGCCTCTCACAGACAGAGTGGACAGCTTCAATGAGGAAGTTCGGAAACAGAGGGTGTCC
NM_002213.3         CTGCCTCTCACAGACAGAGTGGACAGCTTCAATGAGGAAGTTCGGAAACAGAGGGTGTCC
XM_005247436.1      CTGCCTCTCACAGACAGAGTGGACAGCTTCAATGAGGAAGTTCGGAAACAGAGGGTGTCC
                    ************************************************************

HsCD00004487        CGGAACCGAGATGCCCCTGAGGGGGGCTTTGATGCAGTACTCCAGGCAGCCGTCTGCAAG
NM_002213.3         CGGAACCGAGATGCCCCTGAGGGGGGCTTTGATGCAGTACTCCAGGCAGCCGTCTGCAAG
XM_005247436.1      CGGAACCGAGATGCCCCTGAGGGGGGCTTTGATGCAGTACTCCAGGCAGCCGTCTGCAAG
                    ************************************************************

HsCD00004487        GAGAAGATTGGCTGGCGAAAGGATGCACTGCATTTGCTGGTGTTCACAACAGATGATGTG
NM_002213.3         GAGAAGATTGGCTGGCGAAAGGATGCACTGCATTTGCTGGTGTTCACAACAGATGATGTG
XM_005247436.1      GAGAAGATTGGCTGGCGAAAGGATGCACTGCATTTGCTGGTGTTCACAACAGATGATGTG
                    ************************************************************

HsCD00004487        CCCCACATCGCATTGGATGGAAAATTGGGAGGCCTGGTGCAGCCACACGATGGCCAGTGC
NM_002213.3         CCCCACATCGCATTGGATGGAAAATTGGGAGGCCTGGTGCAGCCACACGATGGCCAGTGC
XM_005247436.1      CCCCACATCGCATTGGATGGAAAATTGGGAGGCCTGGTGCAGCCACACGATGGCCAGTGC
                    ************************************************************

HsCD00004487        CACCTGAACGAGGCCAACGAGTACACTGCATCCAACCAGATGGACTATCCATCCCTTGCC
NM_002213.3         CACCTGAACGAGGCCAACGAGTACACTGCATCCAACCAGATGGACTATCCATCCCTTGCC
XM_005247436.1      CACCTGAACGAGGCCAACGAGTACACTGCATCCAACCAGATGGACTATCCATCCCTTGCC
                    ************************************************************

HsCD00004487        TTGCTTGGAGAGAAATTGGCAGAGAACAACATCAACCTCATCTTTGCAGTGACAAAAAAC
NM_002213.3         TTGCTTGGAGAGAAATTGGCAGAGAACAACATCAACCTCATCTTTGCAGTGACAAAAAAC
XM_005247436.1      TTGCTTGGAGAGAAATTGGCAGAGAACAACATCAACCTCATCTTTGCAGTGACAAAAAAC
                    ************************************************************

HsCD00004487        CATTATATGCTGTACAAGAATTTTACAGCCCTGATACCTGGAACAACGGTGGAGATTTTA
NM_002213.3         CATTATATGCTGTACAAGAATTTTACAGCCCTGATACCTGGAACAACGGTGGAGATTTTA
XM_005247436.1      CATTATATGCTGTACAAGAG----------------------------------------
                    *******************.                                        

HsCD00004487        GATGGAGACTCCAAAAATATTATTCAACTGATTATTAATGCATACAATAGTATCCGGTCT
NM_002213.3         GATGGAGACTCCAAAAATATTATTCAACTGATTATTAATGCATACAATAGTATCCGGTCT
XM_005247436.1      --------------------------------------------------TATCCGGTCT
                                                                      **********

HsCD00004487        AAAGTGGAGTTGTCAGTCTGGGATCAGCCTGAGGATCTTAATCTCTTCTTTACTGCTACC
NM_002213.3         AAAGTGGAGTTGTCAGTCTGGGATCAGCCTGAGGATCTTAATCTCTTCTTTACTGCTACC
XM_005247436.1      AAAGTGGAGTTGTCAGTCTGGGATCAGCCTGAGGATCTTAATCTCTTCTTTACTGCTACC
                    ************************************************************

HsCD00004487        TGCCAAGATGGGGTATCCTATCCTGGTCAGAGGAAGTGTGAGGGTCTGAAGATTGGGGAC
NM_002213.3         TGCCAAGATGGGGTATCCTATCCTGGTCAGAGGAAGTGTGAGGGTCTGAAGATTGGGGAC
XM_005247436.1      TGCCAAGATGGGGTATCCTATCCTGGTCAGAGGAAGTGTGAGGGTCTGAAGATTGGGGAC
                    ************************************************************

HsCD00004487        ACGGCATCTTTTGAAGTATCATTGGAGGCCCGAAGCTGTCCCAGCAGACACACGGAGCAT
NM_002213.3         ACGGCATCTTTTGAAGTATCATTGGAGGCCCGAAGCTGTCCCAGCAGACACACGGAGCAT
XM_005247436.1      ACGGCATCTTTTGAAGTATCATTGGAGGCCCGAAGCTGTCCCAGCAGACACACGGAGCAT
                    ************************************************************

HsCD00004487        GTGTTTGCCCTGCGGCCGGTGGGATTCCGGGACAGCCTGGAGGTGGGGGTCACCTACAAC
NM_002213.3         GTGTTTGCCCTGCGGCCGGTGGGATTCCGGGACAGCCTGGAGGTGGGGGTCACCTACAAC
XM_005247436.1      GTGTTTGCCCTGCGGCCGGTGGGATTCCGGGACAGCCTGGAGGTGGGGGTCACCTACAAC
                    ************************************************************

HsCD00004487        TGCACGTGCGGCTGCAGCGTGGGGCTGGAACCCAACAGTGCCAGGTGCAACGGGAGCGGG
NM_002213.3         TGCACGTGCGGCTGCAGCGTGGGGCTGGAACCCAACAGTGCCAGGTGCAACGGGAGCGGG
XM_005247436.1      TGCACGTGCGGCTGCAGCGTGGGGCTGGAACCCAACAGCGCCAGGTGCAACGGGAGCGGG
                    ************************************** *********************

HsCD00004487        ACCTATGTCTGCGGCCTGTGTGAGTGCAGCCCCGGCTACCTGGGCACCAGGTGCGAGTGC
NM_002213.3         ACCTATGTCTGCGGCCTGTGTGAGTGCAGCCCCGGCTACCTGGGCACCAGGTGCGAGTGC
XM_005247436.1      ACCTATGTCTGCGGCCTGTGTGAGTGCAGCCCCGGCTACCTGGGCACCAGGTGCGAGTGC
                    ************************************************************

HsCD00004487        CAGGATGGGGAGAACCAGAGCGTGTACCAGAACCTGTGCCGGGAGGCAGAGGGCAAGCCA
NM_002213.3         CAGGATGGGGAGAACCAGAGCGTGTACCAGAACCTGTGCCGGGAGGCAGAGGGCAAGCCA
XM_005247436.1      CAGGATGGGGAGAACCAGAGCGTGTACCAGAACCTGTGCCGGGAGGCAGAGGGCAAGCCA
                    ************************************************************

HsCD00004487        CTGTGCAGCGGGCGTGGGGACTGCAGCTGCAACCAGTGCTCCTGCTTCGAGAGCGAGTTC
NM_002213.3         CTGTGCAGCGGGCGTGGGGACTGCAGCTGCAACCAGTGCTCCTGCTTCGAGAGCGAGTTC
XM_005247436.1      CTGTGCAGCGGGCGTGGGGACTGCAGCTGCAACCAGTGCTCCTGCTTCGAGAGCGAGTTT
                    *********************************************************** 

HsCD00004487        GGCAAGATCTATGGGCCTTTCTGTGAGTGCGACAACTTCTCCTGTGCCAGGAACAAGGGA
NM_002213.3         GGCAAGATCTATGGGCCTTTCTGTGAGTGCGACAACTTCTCCTGTGCCAGGAACAAGGGA
XM_005247436.1      GGCAAGATCTATGGGCCTTTCTGTGAGTGCGACAACTTCTCCTGTGCCAGGAACAAGGGA
                    ************************************************************

HsCD00004487        GTCCTCTGCTCAGGCCATGGCGAGTGTCACTGCGGGGAATGCAAGTGCCATGCAGGTTAC
NM_002213.3         GTCCTCTGCTCAGGCCATGGCGAGTGTCACTGCGGGGAATGCAAGTGCCATGCAGGTTAC
XM_005247436.1      GTCCTCTGCTCAGGCCATGGCGAGTGTCACTGCGGGGAATGCAAGTGCCATGCAGGTTAC
                    ************************************************************

HsCD00004487        ATCGGGGACAACTGTAACTGCTCGACAGACATCAGCACATGCCGGGGCAGAGATGGCCAG
NM_002213.3         ATCGGGGACAACTGTAACTGCTCGACAGACATCAGCACATGCCGGGGCAGAGATGGCCAG
XM_005247436.1      ATCGGGGACAACTGTAACTGCTCGACAGACATCAGCACATGCCGGGGCAGAGATGGCCAG
                    ************************************************************

HsCD00004487        ATCTGCAGCGAGCGTGGGCACTGTCTCTGTGGGCAGTGCCAATGCACGGAGCCGGGGGCC
NM_002213.3         ATCTGCAGCGAGCGTGGGCACTGTCTCTGTGGGCAGTGCCAATGCACGGAGCCGGGGGCC
XM_005247436.1      ATCTGCAGCGAGCGTGGGCACTGTCTCTGTGGGCAGTGCCAATGCACGGAGCCGGGGGCC
                    ************************************************************

HsCD00004487        TTTGGGGAGATGTGTGAGAAGTGCCCCACCTGCCCGGATGCATGCAGCACCAAGAGAGAT
NM_002213.3         TTTGGGGAGATGTGTGAGAAGTGCCCCACCTGCCCGGATGCATGCAGCACCAAGAGAGAT
XM_005247436.1      TTTGGGGAGATGTGTGAGAAGTGCCCCACCTGCCCGGATGCATGCAGCACCAAGAGAGAT
                    ************************************************************

HsCD00004487        TGCGTCGAGTGCCTGCTGCTCCACTCTGGGAAACCTGACAACCAGACCTGCCACAGCCTA
NM_002213.3         TGCGTCGAGTGCCTGCTGCTCCACTCTGGGAAACCTGACAACCAGACCTGCCACAGCCTA
XM_005247436.1      TGCGTCGAGTGCCTGCTGCTCCACTCTGGGAAACCTGACAACCAGACCTGCCACAGCCTA
                    ************************************************************

HsCD00004487        TGCAGGGATGAGGTGATCACATGGGTGGACACCATCGTGAAAGATGACCAGGAGGCTGTG
NM_002213.3         TGCAGGGATGAGGTGATCACATGGGTGGACACCATCGTGAAAGATGACCAGGAGGCTGTG
XM_005247436.1      TGCAGGGATGAGGTGATCACATGGGTGGACACCATCGTGAAAGATGACCAGGAGGCTGTG
                    ************************************************************

HsCD00004487        CTATGTTTCTACAAAACCGCCAAGGACTGCGTCATGATGTTCACCTATGTGGAGCTCCCC
NM_002213.3         CTATGTTTCTACAAAACCGCCAAGGACTGCGTCATGATGTTCACCTATGTGGAGCTCCCC
XM_005247436.1      CTATGTTTCTACAAAACCGCCAAGGACTGCGTCATGATGTTCACCTATGTGGAGCTCCCC
                    ************************************************************

HsCD00004487        AGTGGGAAGTCCAACCTGACCGTCCTCAGGGAGCCAGAGTGTGGAAACACCCCCAACGCC
NM_002213.3         AGTGGGAAGTCCAACCTGACCGTCCTCAGGGAGCCAGAGTGTGGAAACACCCCCAACGCC
XM_005247436.1      AGTGGGAAGTCCAACCTGACCGTCCTCAGGGAGCCAGAGTGTGGAAACACCCCCAACGCC
                    ************************************************************

HsCD00004487        ATGACCATCCTCCTGGCTGTGGTCGGTAGCATCCTCCTTGTTGGGCTTGCACTCCTGGCT
NM_002213.3         ATGACCATCCTCCTGGCTGTGGTCGGTAGCATCCTCCTTGTTGGGCTTGCACTCCTGGCT
XM_005247436.1      ATGACCATCCTCCTGGCTGTGGTCGGTAGCATCCTCCTTGTTGGGCTTGCACTCCTGGCT
                    ************************************************************

HsCD00004487        ATCTGGAAGCTGCTTGTCACCATCCACGACCGGAGGGAGTTTGCAAAGTTTCAGAGCGAG
NM_002213.3         ATCTGGAAGCTGCTTGTCACCATCCACGACCGGAGGGAGTTTGCAAAGTTTCAGAGCGAG
XM_005247436.1      ATCTGGAAGCTGCTTGTCACCATCCACGACCGGAGGGAGTTTGCAAAGTTTCAGAGCGAG
                    ************************************************************

HsCD00004487        CGATCCAGGGCCCGCTATGAAATGGCTTCAAATCCATTATACAGAAAGCCTATCTCCACG
NM_002213.3         CGATCCAGGGCCCGCTATGAAATGGCTTCAAATCCATTATACAGAAAGCCTATCTCCACG
XM_005247436.1      CGATCCAGGGCCCGCTATGAAATGGCTTCAAATCCATTATACAGAAAGCCTATCTCCACG
                    ************************************************************

HsCD00004487        CACACTGTGGACTTCACCTTCAACAAGTTCAACAAATCCTACAATGGCACTGTGGACTTG
NM_002213.3         CACACTGTGGACTTCACCTTCAACAAGTTCAACAAATCCTACAATGGCACTGTGGACTGA
XM_005247436.1      CACACTGTGGACTTCACCTTCAACAAGTTCAACAAATCCTACAATGGCACTGTGGACTGA
                    ********************************************************** .

Pathways

NCI : Beta5 beta6 beta7 and beta8 integrin cell surface interactions
NCI : Integrin family cell surface interactions
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Signaling events mediated by focal adhesion kinase
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
Panther : Integrin signalling pathway
Reactome : Adaptive Immune System
Reactome : Antigen processing-Cross presentation
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Cross-presentation of particulate exogenous antigens (phagosomes)
Reactome : ECM proteoglycans
Reactome : Elastic fibre formation
Reactome : Extracellular matrix organization
Reactome : Immune System
Reactome : Integrin cell surface interactions
Reactome : Molecules associated with elastic fibres
Reactome : Muscle contraction
Reactome : Non-integrin membrane-ECM interactions
Reactome : Smooth Muscle Contraction
Reactome : Syndecan interactions
WikiPathway : Focal Adhesion
WikiPathway : Integrin-mediated cell adhesion

Clone

Cloning Information : 15901
HIP Master Clone ID : 30100
Original Clone ID : FLH015901.01L

Organism


TAX_ID : 9606
Species Specific ID: 3693

Genome

Chromosome : 3
Map Location : 3q21.2
Ensembl : ENSG00000082781

Reagents

Labome : ITGB5-antibody