DNASU Plasmid Repository • 480.965.5697 | Email

resE (B. subtilis subsp. subtilis str. 168 ) in pMCSG19

TOP

Explanation of Terms


Gene: Gene Symbol:  resE
Gene Name:  sensor histidine kinase
Sequence             
Original Clone ID: APC1983.7_SG230_pMCSG19
Keyword: partial cds
Species: Bacillus subtilis subsp. subtilis str. 168
Type: cDNA
Vector Name: pMCSG19               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Midwest Center for Structural Genomics
Kimberly Buck
BsCD00449847

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1164nts         Open reading frame : 43 to 1206

ATCGCGGGATTGGGTACGAAACCTGTACTTCCATCCAATGCCAGCAGGGTCACGTACCCT
CTCCGAAAAATGAGAGAAGGCGCGCAGGATTTGGCGAAGGGCAAGTTCGATACAAAAATC
CCGATTTTAACTCAGGATGAAATCGGTGAACTGGCGACCGCTTTTAATCAAATGGGCCGG
CAGCTTAACTTTCATATCAATGCGCTCAATCAAGAAAAAGAGCAGCTTTCTAACATTTTG
AGCAGTATGGCTGACGGGGTTATTACCATTAATATTGACGGTACGATTCTTGTGACCAAC
CCGCCGGCTGAACGTTTTCTTCAGGCTTGGTATTATGAACAGAACATGAATATCAAAGAA
GGCGACAATCTTCCGCCTGAAGCAAAAGAGCTGTTTCAAAACGCTGTCAGCACTGAAAAA
GAACAAATGATTGAGATGACGCTTCAAGGCAGATCATGGGTGCTTTTGATGTCGCCGCTT
TATGCGGAATCGCACGTCAGAGGAGCGGTTGCCGTACTGCGTGACATGACAGAAGAACGC
CGCCTTGATAAGCTGCGGGAGGACTTTATCGCAAATGTCAGTCATGAGCTGAGAACACCG
ATCTCCATGCTTCAGGGATACAGTGAAGCAATTGTCGATGACATTGCAAGCTCTGAAGAA
GACCGGAAAGAAATTGCCCAAATCATTTATGACGAATCGCTCCGAATGGGCCGTTTAGTT
AATGATTTGCTTGATTTAGCCCGAATGGAATCAGGCCATACAGGCTTACATTATGAAAAA
ATCAATGTGAATGAGTTTTTAGAAAAGATCATTCGGAAGTTTTCCGGTGTTGCGAAAGAA
AAAAATATTGCTTTAGATCATGACATTTCTCTCACAGAAGAGGAATTTATGTTTGATGAA
GACAAGATGGAGCAGGTATTTACCAATTTGATTGATAACGCGCTGCGGCATACTTCAGCC
GGCGGCAGTGTCTCCATTTCAGTCCATTCTGTGAAGGATGGATTGAAAATTGATATCAAA
GACTCCGGGTCTGGCATACCGGAAGAAGATCTGCCATTTATCTTTGAGCGGTTTTATAAG
GCAGATAAAGCGCGGACAAGGGGCAGAGCAGGAACCGGGTTAGGGCTGGCTATCGTTAAA
AATATCGTGGAAGCCCACAACGGATCAATTACTGTGCACAGCCGAATAGATAAAGGAACA
ACATAACATTGGAAGTGGATAACGGATCCGAATTCGAGCTCCGTC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GCC

3' Linker Sequence:
TAAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Applicable
SolubleProtein: Protein_Soluble
Find experimental protocols in APC1983.7
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG19

pMCSG19 in advanced viewed

Synonyms: pMCSG-19
Sequencing Primer: Forward:  ANForward
Reverse:  T7 terminator
Description: Vector for solubility of insert and for purification, with T7 promoter, adds N-terminal MBP, TVMV, His, TEV, NA; amp resistance; ligation independent cloning (LIC).
Comments: pMCSG7 derivative: in vivo TVMV cleavage of MBP
Size (bp): 6441
Parent Vector: None
Empty Vector: EvNO00084265
Properties: bacterial expression, improves solubility of insert, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 16497515
Title: An expression vector tailored for large-scale, high-throughput purification of recombinant proteins

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC Ligation independent cloning (LIC) site 204 235
bacterial origin ori ColE1-type bacterial origin of replication 4416 5098
promoter T7 T7 promoter 1515 1531
protease cleavage site TVMV TVMV protease cleavage site 286 306
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 1490 1512
repressor protein gene LacI LacI coding sequence 2045 3004
selectable marker AmpR ampicillin resistance gene 5193 6053
tag His 2 C-terminal 6xHis tag 140 157
tag His 6xHis tag 268 285
tag MBP N-terminal MBP 337 1443
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : resE
GENEID : 938965
Locus Tag : BSU23110
GI : 221310229
Target GenBank: None

 

Clone

Cloning Information : 529238
HIP Master Clone ID : 439558
Original Clone ID : APC1983.7_SG230_pMCSG19

Experimental

TargetTrack - Experimental data : APC1983.7

Organism


TAX_ID : 224308
Species Specific ID: 938965

Reagents

Labome : resE-cDNA