DNASU Plasmid Repository • 480.965.5697 | Email

AKR1C3 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AKR1C3
Gene Name:  aldo-keto reductase family 1, member C3
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH025839.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00004506

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 972nts         Open reading frame : 1 to 972
Reference Sequence Alignment

ATGGATTCCAAACACCAGTGTGTAAAGCTAAATGATGGCCACTTCATGCCTGTATTGGGA
TTTGGCACCTATGCACCTCCAGAGGTTCCAAGAAGTAAAGCTTTGGAGGTCACAAAATTA
GCAATAGAAGCTGGGTTCCGCCATATAGATTCTGCTCATTTATACAATAATGAGGAGCAG
GTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTC
TACACTTCAAAGCTTTGGTCCACTTTTCATCGACCAGAGTTGGTCCGACCAGCCTTGGAA
AACTCACTGAAAAAAGCTCAATTGGACTATGTTGACCTCTATCTTATTCATTCTCCAATG
TCTCTAAAGCCAGGTGAGGAACTTTCACCAACAGATGAAAATGGAAAAGTAATATTTGAC
ATAGTGGATCTCTGTACCACCTGGGAGGCCATGGAGAAGTGTAAGGATGCAGGATTGGCC
AAGTCCATTGGGGTGTCAAACTTCAACCGCAGGCAGCTGGAGATGATCCTCAACAAGCCA
GGACTTAAGTACAAGCCTGTCTGCAACCAGGTAGAATGTCATCCGTATTTCAACCGGAGT
AAATTGCTAGATTTCTGCAAGTCGAAAGATATTGTTCTGGTTGCCTATAGTGCTCTGGGA
TCTCAACGAGACAAACGATGGGTGGACCCGAACTCCCCGGTGCTCTTGGAGGACCCAGTC
CTTTGTGCCTTGGCAAAAAAGCACAAGCGAACCCCAGCCCTGATTGCCCTGCGCTACCAG
CTGCAGCGTGGGGTTGTGGTCCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAAC
GTGCAGGTTTTTGAGTTCCAGTTGACTGCAGAGGACATGAAAGCCATAGATGGCCTAGAC
AGAAATCTCCACTATTTTAACAGTGATAGTTTTGCTAGCCACCCTAATTATCCATATTCA
GATGAATATTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1037
Start on reference sequence 66
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : AKR1C3
Symbol Nomenclature : AKR1C3
SYNONYM : DD3; DDX; HA1753; HAKRB; HAKRe; HSD17B5; PGFS; hluPGFS
Designation : 3-alpha hydroxysteroid dehydrogenase, type II|3-alpha-HSD type II, brain|aldo-keto reductase family 1 member C3|aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)|chlordecone reductase homolog HAKRb|dihydrodiol dehydrogenase 3|dihydrodiol dehydrogenase X|indanol dehydrogenase|prostaglandin F synthase|testosterone 17-beta-dehydrogenase 5|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase|type IIb 3-alpha hydroxysteroid dehydrogenase
Full Nomenclature : aldo-keto reductase family 1, member C3
GENEID : 8644
GI : 61361891
GenBank Accession : AY890179
HGNC : 386
MIM : 603966
Vega : OTTHUMG00000017585
Target GenBank: BC001479

 

Reference Sequence Alignment

  

HsCD00004506        ATGGATTCCAAACACCAGTGTGTAAAGCTAAATGATGGCCACTTCATGCCTGTATTGGGA
NM_001253908.1      ATGGATTCAAAACATCAGTGTTTGAAGCTAAATGATGGTCACTTCATGCCTGTCCTGGGA
NM_003739.5         ATGGATTCCAAACACCAGTGTGTAAAGCTAAATGATGGCCACTTCATGCCTGTATTGGGA
                    ********.***** ****** *.************** **************. *****

HsCD00004506        TTTGGCACCTATGCACCTCCAGAGGTTCCAAGAAGTAAAGCTTTGGAGGTCACAAAATTA
NM_001253908.1      TTTGGCACCTATGCACCTCCAGAGGTTCCGAGAAGTAAAGCTTTGGAGGTCACAAAATTA
NM_003739.5         TTTGGCACCTATGCACCTCCAGAGGTTCCGAGAAGTAAAGCTTTGGAGGTCACAAAATTA
                    *****************************.******************************

HsCD00004506        GCAATAGAAGCTGGGTTCCGCCATATAGATTCTGCTCATTTATACAATAATGAGGAGCAG
NM_001253908.1      GCAATAGAAGCTGGGTTCCGCCATATAGATTCTGCTCATTTATACAATAATGAGGAGCAG
NM_003739.5         GCAATAGAAGCTGGGTTCCGCCATATAGATTCTGCTCATTTATACAATAATGAGGAGCAG
                    ************************************************************

HsCD00004506        GTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTC
NM_001253908.1      GTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTC
NM_003739.5         GTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTC
                    ************************************************************

HsCD00004506        TACACTTCAAAGCTTTGGTCCACTTTTCATCGACCAGAGTTGGTCCGACCAGCCTTGGAA
NM_001253908.1      TACACTTCAAAGCTTTGGTCCACTTTTCATCGACCAGAGTTGGTCCGACCAGCCTTGGAA
NM_003739.5         TACACTTCAAAGCTTTGGTCCACTTTTCATCGACCAGAGTTGGTCCGACCAGCCTTGGAA
                    ************************************************************

HsCD00004506        AACTCACTGAAAAAAGCTCAATTGGACTATGTTGACCTCTATCTTATTCATTCTCCAATG
NM_001253908.1      AACTCACTGAAGAAAGCTCAATTGGACTATGTTGACCTCTATCTTATTCATTCTCCAATG
NM_003739.5         AACTCACTGAAGAAAGCTCAATTGGACTATGTTGACCTCTATCTTATTCATTCTCCAATG
                    ***********.************************************************

HsCD00004506        TCTCTAAAGCCAGGTGAGGAACTTTCACCAACAGATGAAAATGGAAAAGTAATATTTGAC
NM_001253908.1      TCTCTAAAGCCAGGTGAGGAACTTTCACCAACAGATGAAAATGGAAAAGTAATATTTGAC
NM_003739.5         TCTCTAAAGCCAGGTGAGGAACTTTCACCAACAGATGAAAATGGAAAAGTAATATTTGAC
                    ************************************************************

HsCD00004506        ATAGTGGATCTCTGTACCACCTGGGAGGCCATGGAGAAGTGTAAGGATGCAGGATTGGCC
NM_001253908.1      ATAGTGGATCTCTGTACCACCTGGGAGGCCATGGAGAAGTGTAAGGATGCAGGATTGGCC
NM_003739.5         ATAGTGGATCTCTGTACCACCTGGGAGGCCATGGAGAAGTGTAAGGATGCAGGATTGGCC
                    ************************************************************

HsCD00004506        AAGTCCATTGGGGTGTCAAACTTCAACCGCAGGCAGCTGGAGATGATCCTCAACAAGCCA
NM_001253908.1      AAGTCCATTGGGGTGTCAAACTTCAACCGCAGGCAGCTGGAGATGATCCTCAACAAGCCA
NM_003739.5         AAGTCCATTGGGGTGTCAAACTTCAACCGCAGGCAGCTGGAGATGATCCTCAACAAGCCA
                    ************************************************************

HsCD00004506        GGACTTAAGTACAAGCCTGTCTGCAACCAGGTAGAATGTCATCCGTATTTCAACCGGAGT
NM_001253908.1      GGACTCAAGTACAAGCCTGTCTGCAACCAGGTAGAATGTCATCCGTATTTCAACCGGAGT
NM_003739.5         GGACTCAAGTACAAGCCTGTCTGCAACCAGGTAGAATGTCATCCGTATTTCAACCGGAGT
                    ***** ******************************************************

HsCD00004506        AAATTGCTAGATTTCTGCAAGTCGAAAGATATTGTTCTGGTTGCCTATAGTGCTCTGGGA
NM_001253908.1      AAATTGCTAGATTTCTGCAAGTCGAAAGATATTGTTCTGGTTGCCTATAGTGCTCTGGGA
NM_003739.5         AAATTGCTAGATTTCTGCAAGTCGAAAGATATTGTTCTGGTTGCCTATAGTGCTCTGGGA
                    ************************************************************

HsCD00004506        TCTCAACGAGACAAACGATGGGTGGACCCGAACTCCCCGGTGCTCTTGGAGGACCCAGTC
NM_001253908.1      TCTCAACGAGACAAACGATGGGTGGACCCGAACTCCCCGGTGCTCTTGGAGGACCCAGTC
NM_003739.5         TCTCAACGAGACAAACGATGGGTGGACCCGAACTCCCCGGTGCTCTTGGAGGACCCAGTC
                    ************************************************************

HsCD00004506        CTTTGTGCCTTGGCAAAAAAGCACAAGCGAACCCCAGCCCTGATTGCCCTGCGCTACCAG
NM_001253908.1      CTTTGTGCCTTGGCAAAAAAGCACAAGCGAACCCCAGCCCTGATTGCCCTGCGCTACCAG
NM_003739.5         CTTTGTGCCTTGGCAAAAAAGCACAAGCGAACCCCAGCCCTGATTGCCCTGCGCTACCAG
                    ************************************************************

HsCD00004506        CTGCAGCGTGGGGTTGTGGTCCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAAC
NM_001253908.1      CTGCAGCGTGGGGTTGTGGTCCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAAC
NM_003739.5         CTGCAGCGTGGGGTTGTGGTCCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAAC
                    ************************************************************

HsCD00004506        GTGCAGGTTTTTGAGTTCCAGTTGACTGCAGAGGACATGAAAGCCATAGATGGCCTAGAC
NM_001253908.1      GTGCAGGTTTTTGAGTTCCAGTTGACTGCAGAGGACATGAAAGCCATAGATGGCCTAGAC
NM_003739.5         GTGCAGGTTTTTGAGTTCCAGTTGACTGCAGAGGACATGAAAGCCATAGATGGCCTAGAC
                    ************************************************************

HsCD00004506        AGAAATCTCCACTATTTTAACAGTGATAGTTTTGCTAGCCACCCTAATTATCCATATTCA
NM_001253908.1      AGAAATCTCCACTATTTTAACAGTGATAGTTTTGCTAGCCACCCTAATTATCCATATTCA
NM_003739.5         AGAAATCTCCACTATTTTAACAGTGATAGTTTTGCTAGCCACCCTAATTATCCATATTCA
                    ************************************************************

HsCD00004506        GATGAATATTAG
NM_001253908.1      GATGAATATTAA
NM_003739.5         GATGAATATTAA
                    ***********.

Pathways

Reactome : Arachidonic acid metabolism
Reactome : Bile acid and bile salt metabolism
Reactome : Disease
Reactome : Diseases associated with visual transduction
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Retinoid metabolism and transport
Reactome : Signal Transduction
Reactome : Synthesis of Prostaglandins (PG) and Thromboxanes (TX)
Reactome : Synthesis of bile acids and bile salts
Reactome : Synthesis of bile acids and bile salts via 24-hydroxycholesterol
Reactome : Synthesis of bile acids and bile salts via 27-hydroxycholesterol
Reactome : Synthesis of bile acids and bile salts via 7alpha-hydroxycholesterol
Reactome : Visual phototransduction
WikiPathway : Benzo(a)pyrene metabolism
WikiPathway : metapathway biotransformation

Protein

UniProt : P42330
HPRD : 04911

Clone

Cloning Information : 25839
HIP Master Clone ID : 56215
Original Clone ID : FLH025839.01X

Organism


TAX_ID : 9606
Species Specific ID: 8644

Genome

Chromosome : 10
Map Location : 10p15-p14
Ensembl : ENSG00000196139

Reagents

Labome : AKR1C3-antibody