DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJSP6_nHalo_empty

TOP

Explanation of Terms


Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pJSP6_nHalo_empty              
Source: Center for Personalized Diagnostics
Description: Wheat germ expression vector with SP6 promoter and TEV-cleavable N-terminal HALO tag; ampicillin resistance in bacteria; gateway cloning
Comments: None
Publications: None
Authors: Joshua LaBaer
Center for Personalized Diagnostics
Arizona State University
Ji Qiu
Justin Saul
EvNO00450884

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: HALO

 

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJSP6_nHalo_empty

pJSP6_nHalo_empty in advanced viewed

Synonyms: pEU-nHalo_empty
Sequencing Primer: Forward:  HaloseqF
Reverse:  pF1KseqR
Description: Wheat germ expression vector with SP6 promoter and TEV-cleavable N-terminal HALO tag; ampicillin resistance in bacteria; gateway cloning
Comments: Modified from pEU_HSBC, expresses Halo tag without an insert
Size (bp): 4775
Parent Vector: None
Properties: Gateway, acceptor (destination), cell-free expression, recombinational cloning, with tag/fusion/marker
Author Name: Joshua LaBaer
Center for Personalized Diagnostics
Arizona State University
Ji Qiu
Justin Saul
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
IRES TMV Omega TMV Omega IRES 9 131
bacterial origin ColE ColE1 bacterial origin 2229 2911
primer reverse primer pF1KseqR reverse sequencing primer CTTTCGGGCTTTGTTAGCAG 1163 1182
primer forward primer HaloseqF forward sequencing primer aagcctgcctaactgcaa 902 919
promoter SP6 SP6 promoter 4759 4775
protease cleavage site TEV TEV protease cleavage site EDLYFQS 1035 1055
selectable marker AmpR Ampicillin resistance 3009 3668
tag HALO N-terminal HALO tag 132 1022
trxn termination sequence T7 term T7 terminator 1132 1145

 

Species Specific ID: None
Target GenBank: None