DNASU Plasmid Repository • 480.965.5697 | Email

STUB1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  STUB1
Gene Name:  STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH194923.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00045213

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 912nts         Open reading frame : 1 to 912
Reference Sequence Alignment

ATGAAGGGCAAGGAGGAGAAGGAGGGCGGCGCACGGCTGGGCGCTGGCGGCGGAAGCCCC
GAGAAGAGCCCGAGCGCGCAGGAGCTCAAGGAGCAGGGCAATCGTCTGTTCGTGGGCCGA
AAGTACCCGGAGGCGGCGGCCTGCTACGGCCGCGCGATCACCCGGAACCCGCTGGTGGCC
GTGTATTACACCAACCGGGCCTTGTGCTACCTGAAGATGCAGCAGCACGAGCAGGCCCTG
GCCGACTGCCGGCGCGCCCTGGAGCTGGACGGGCAGTCTGTGAAGGCGCACTTCTTCCTG
GGGCAGTGCCAGCTGGAGATGGAGAGCTATGATGAGGCCATCGCCAATCTGCAGCGAGCT
TACAGCCTGGCCAAGGAGCAGCGGCTGAACTTCGGGGACGACATCCCCAGCGCTCTTCGA
ATCGCGAAGAAGAAGCGCTGGAACAGCATTGAGGAGCGGCGCATCCACCAGGAGAGCGAG
CTGCACTCCTACCTCTCCAGGCTCATTGCCGCGGAGCGTGAGAGGGAGCTGGAAGAGTGC
CAGCGAAACCACGAGGGTGATGAGGACGACAGCCACGTCCGGGCCCAGCAGGCCTGCATT
GAGGCCAAGCACGACAAGTACATGGCGGACATGGACGAGCTTTTTTCTCAGGTGGATGAG
AAGAGGAAGAAGCGAGACATCCCCGACTACCTGTGTGGCAAGATCAGCTTTGAGCTGATG
CGGGAGCCGTGCATCACGCCCAGTGGCATCACCTACGACCGCAAGGACATCGAGGAGCAC
CTGCAGCGTGTGGGTCATTTTGACCCCGTGACCCGGAGCCCCCTGACCCAGGAACAGCTC
ATCCCCAACTTGGCTATGAAGGAGGTTATTGACGCATTCATCTCTGAGAATGGCTGGGTG
GAGGACTACTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1011
Start on reference sequence 100
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : STUB1
Symbol Nomenclature : STUB1
SYNONYM : CHIP; HSPABP2; NY-CO-7; SDCCAG7; UBOX1
Designation : CLL-associated antigen KW-8|E3 ubiquitin-protein ligase CHIP|STIP1 homology and U box-containing protein 1|antigen NY-CO-7|carboxy terminus of Hsp70-interacting protein|heat shock protein A binding protein 2 (c-terminal)|serologically defined colon cancer antigen 7
Full Nomenclature : STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
GENEID : 10273
Locus Tag : LA16c-313D11.6
HGNC : 11427
MIM : 607207
Vega : OTTHUMG00000121140
Target GenBank: BC007545

 

Reference Sequence Alignment

  

HsCD00045213      ATGAAGGGCAAGGAGGAGAAGGAGGGCGGCGCACGGCTGGGCGCTGGCGGCGGAAGCCCC
NM_005861.2       ATGAAGGGCAAGGAGGAGAAGGAGGGCGGCGCACGGCTGGGCGCTGGCGGCGGAAGCCCC
                  ************************************************************

HsCD00045213      GAGAAGAGCCCGAGCGCGCAGGAGCTCAAGGAGCAGGGCAATCGTCTGTTCGTGGGCCGA
NM_005861.2       GAGAAGAGCCCGAGCGCGCAGGAGCTCAAGGAGCAGGGCAATCGTCTGTTCGTGGGCCGA
                  ************************************************************

HsCD00045213      AAGTACCCGGAGGCGGCGGCCTGCTACGGCCGCGCGATCACCCGGAACCCGCTGGTGGCC
NM_005861.2       AAGTACCCGGAGGCGGCGGCCTGCTACGGCCGCGCGATCACCCGGAACCCGCTGGTGGCC
                  ************************************************************

HsCD00045213      GTGTATTACACCAACCGGGCCTTGTGCTACCTGAAGATGCAGCAGCACGAGCAGGCCCTG
NM_005861.2       GTGTATTACACCAACCGGGCCTTGTGCTACCTGAAGATGCAGCAGCACGAGCAGGCCCTG
                  ************************************************************

HsCD00045213      GCCGACTGCCGGCGCGCCCTGGAGCTGGACGGGCAGTCTGTGAAGGCGCACTTCTTCCTG
NM_005861.2       GCCGACTGCCGGCGCGCCCTGGAGCTGGACGGGCAGTCTGTGAAGGCGCACTTCTTCCTG
                  ************************************************************

HsCD00045213      GGGCAGTGCCAGCTGGAGATGGAGAGCTATGATGAGGCCATCGCCAATCTGCAGCGAGCT
NM_005861.2       GGGCAGTGCCAGCTGGAGATGGAGAGCTATGATGAGGCCATCGCCAATCTGCAGCGAGCT
                  ************************************************************

HsCD00045213      TACAGCCTGGCCAAGGAGCAGCGGCTGAACTTCGGGGACGACATCCCCAGCGCTCTTCGA
NM_005861.2       TACAGCCTGGCCAAGGAGCAGCGGCTGAACTTCGGGGACGACATCCCCAGCGCTCTTCGA
                  ************************************************************

HsCD00045213      ATCGCGAAGAAGAAGCGCTGGAACAGCATTGAGGAGCGGCGCATCCACCAGGAGAGCGAG
NM_005861.2       ATCGCGAAGAAGAAGCGCTGGAACAGCATTGAGGAGCGGCGCATCCACCAGGAGAGCGAG
                  ************************************************************

HsCD00045213      CTGCACTCCTACCTCTCCAGGCTCATTGCCGCGGAGCGTGAGAGGGAGCTGGAAGAGTGC
NM_005861.2       CTGCACTCCTACCTCTCCAGGCTCATTGCCGCGGAGCGTGAGAGGGAGCTGGAAGAGTGC
                  ************************************************************

HsCD00045213      CAGCGAAACCACGAGGGTGATGAGGACGACAGCCACGTCCGGGCCCAGCAGGCCTGCATT
NM_005861.2       CAGCGAAACCACGAGGGTGATGAGGACGACAGCCACGTCCGGGCCCAGCAGGCCTGCATT
                  ************************************************************

HsCD00045213      GAGGCCAAGCACGACAAGTACATGGCGGACATGGACGAGCTTTTTTCTCAGGTGGATGAG
NM_005861.2       GAGGCCAAGCACGACAAGTACATGGCGGACATGGACGAGCTTTTTTCTCAGGTGGATGAG
                  ************************************************************

HsCD00045213      AAGAGGAAGAAGCGAGACATCCCCGACTACCTGTGTGGCAAGATCAGCTTTGAGCTGATG
NM_005861.2       AAGAGGAAGAAGCGAGACATCCCCGACTACCTGTGTGGCAAGATCAGCTTTGAGCTGATG
                  ************************************************************

HsCD00045213      CGGGAGCCGTGCATCACGCCCAGTGGCATCACCTACGACCGCAAGGACATCGAGGAGCAC
NM_005861.2       CGGGAGCCGTGCATCACGCCCAGTGGCATCACCTACGACCGCAAGGACATCGAGGAGCAC
                  ************************************************************

HsCD00045213      CTGCAGCGTGTGGGTCATTTTGACCCCGTGACCCGGAGCCCCCTGACCCAGGAACAGCTC
NM_005861.2       CTGCAGCGTGTGGGTCATTTTGACCCCGTGACCCGGAGCCCCCTGACCCAGGAACAGCTC
                  ************************************************************

HsCD00045213      ATCCCCAACTTGGCTATGAAGGAGGTTATTGACGCATTCATCTCTGAGAATGGCTGGGTG
NM_005861.2       ATCCCCAACTTGGCTATGAAGGAGGTTATTGACGCATTCATCTCTGAGAATGGCTGGGTG
                  ************************************************************

HsCD00045213      GAGGACTACTAG
NM_005861.2       GAGGACTACTGA
                  **********..

Pathways

NCI : Alpha-synuclein signaling
Panther : Parkinson disease
Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Disease
Reactome : Downregulation of TGF-beta receptor signaling
Reactome : Immune System
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by ERBB2
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : TGF-beta receptor signaling activates SMADs
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
WikiPathway : Androgen receptor signaling pathway

Protein

SMART domain : Ubox : Modified RING finger domain
SMART domain : TPR : Tetratricopeptide repeats
UniProt : Q9UNE7
HPRD : 06232

Clone

Cloning Information : 194923
HIP Master Clone ID : 169634
Original Clone ID : FLH194923.01X

Organism


TAX_ID : 9606
Species Specific ID: 10273

Genome

Chromosome : 16
Map Location : 16p13.3
Ensembl : ENSG00000103266

Reagents

Labome : CHIP-antibody