DNASU Plasmid Repository • 480.965.5697 | Email

PFL_4533 (Pseudomonas protegens Pf-5) in pMCSG7 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  bdlA
Gene Name:  biofilm dispersion protein BdlA
Sequence             
Original Clone ID: APC67807.0_SG330_pMCSG7
Keyword: full length
Species: Pseudomonas protegens Pf-5
Type: cDNA
Vector Name: pMCSG7               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Midwest Center for Structural Genomics
Jessica Bearden
PfCD00452494

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1320nts         Open reading frame : 48 to 1367

CCGGCGAAATCTCGGGTACCGAGAACCTGTACTTCCAATCCAATGCCATGCTATTCAACC
GCCACAACATTATCACCGATTCCCTGCAGCAAACCATTGCCGAACAATCCCGACTGCTGG
AAGCCATCGATCGCTCCATGGCGGTGATCGAATTCGACCTGCAGGGCAACGTCCTGCGAG
CCAACGCCAACTTTCTCCAGACCCTGGGCTATCGCGAAGACCAGGTGACAGGCCAGCCGC
ACCGCCTCTTCTGCACCCCGGAGTACGTTCGCAGCAGCGACTACCAGCAATTGTGGAACC
GCCTCAGAAGCGGCCAGTTCGAATCCGGAACCTTCGAACGGGTGGCCAGCAACGGCCAGA
GCCTGTGGCTGGAAGCCAGCTACAACCCCATCCGCGACGCATCCGGCGCAGTGTACAAAG
TGGTCAAGTACGCCCTGGATGTCACCGCCCGAGTGCAGGAAGAGGTGGAGGCACGAAACA
AGCTGGACGCCATCGACCGGGCCATGGCGGTGATCGAGTTCAACCTCGACGGCAGCATCA
TCGGTGCCAACAGCAATTTCCTCAGCCGCATGGGCTACAGCCTGGCCGAGATCAAGGGCA
AGCATCACCGCATGTTCTGCAAACCCGAGCTGATCAACAGCAGCGCCTACCAGGACTTCT
GGAACCGCCTGAACCGGGGTGAGTTCTTCAACGGTCAGTTCGAGCGGATCGACAGGCACG
GACGTACGCTGTGGCTGGAAGCCAACTACAACCCGGTCTACGACGCCAGCGGGCGCCTGT
GCAAAGTGGTCAAGTACGCCGCCGACGTCACCCAGCAGGTGGAAAAACACGAACAGGATG
CCCAGAGCGCGAGCCAGGCTTATCACATCTCGGTACAGACCCGAAAAGTCGCCGAACAAG
GCACCGGAGTGATCCAGCAAGCCGCCAGCGAAATGCGCCAGATCGCCGAGAACATCGAGG
GCTCTTCATCGCTGATCGCGCGCCTGGGCGAACGCTCCGAACAGATCACCGCCATCGTCA
ACACCATCCGCGCCATTGCCGACCAGACCAACCTGCTGGCTCTGAACGCCGCCATCGAAG
CGGCCCGGGCCGGGGACCAGGGTCGTGGTTTTGCCGTGGTGGCCGATGAAGTCCGGCAAT
TGGCGGCGCGCACCAGCGGCTCGACGGCGGAAATCTCCAGCATGATCGACATGATCCAGA
ACGAAACGCAGCAAGCCATCAAGAGCATGGACGGTACCCGGGAGCGGGCGGCCAAGGGCG
TGCAACTGGCGGATCAGGCGGGCACGGTGATCCTGCAGATTCGCGACGGTGCCAGCGAGG
CGGTAGAGGCCGTGAGCATGTTCGCCAACGAACGCGGCGCCCCCTAACATTGGAAGTGGA
TAACGGATCCGAATTC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
a23t,g24t,K8I;c26t,T9I
                                

5' Linker Sequence:
GCC

3' Linker Sequence:
TAAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
SolubleProtein: Protein_Soluble
Find experimental protocols in APC67807.0
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG7

pMCSG7 in advanced viewed

Synonyms: pMCSG-7
Sequencing Primer: Forward:  T7short
Reverse:  T7 terminator
Description: Bacterial expresson vector with T7 promoter, adds N-terminal His tag and TEV protease site; amp resistance; ligation independent cloning (LIC).
Comments: pET21 derivative; for routine HTP purification
Size (bp): 5286
Parent Vector: None
Empty Vector: EvNO00084271
Properties: bacterial expression, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 12071693
Title: A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC ligation-independent cloning (LIC) region 204 235
bacterial origin ori ColE1 pBR322-type bacterial origin of replication 3280 3280
promoter T7 T7 promoter 360 376
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 335 357
repressor protein gene LacI LacI coding region 890 1849
selectable marker AmpR ampicillin resistance gene 4038 4898
tag His 2 N-terminal 6xHis tag 268 285
tag His C-terminal 6xHis tag 140 157
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : bdlA
GENEID : 3478648
Locus Tag : PFL_4533
GI : 68346174
Target GenBank: None

 

Clone

Cloning Information : 575736
HIP Master Clone ID : 481335
Original Clone ID : APC67807.0_SG330_pMCSG7

Experimental

TargetTrack - Experimental data : APC67807.0

Organism


TAX_ID : 220664
Species Specific ID: 3478648

Reagents

Labome : bdlA-cDNA