DNASU Plasmid Repository • 480.965.5697 | Email

PntA (Escherichia coli) in PCDF Bravo

TOP

Explanation of Terms


Gene: Gene Symbol:  PntA
Gene Name:  None
Sequence             
Original Clone ID: CSMP-3154
Keyword: None
Species: Escherichia coli
Type: cDNA
Vector Name: PCDF Bravo               Format:  FUSION
Source: Center for Structures of Membrane Proteins
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Structures of Membrane Proteins
University of California San Francisco
William Harries
PSI
EcCD00452777

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1533nts         Open reading frame : 47 to 1579

CGACAAGGGTGCACTTGAAGTCCTCTTTCAAGGACCGAGCAGCCCCTCACGAATTGGCAT
ACCAAGAGAACGGTTAACCAATGAAACCCGTGTTGCAGCAACGCCAAAAACAGTGGAACA
GCTGCTGAAACTGGGTTTTACCGTCGCGGTAGAGAGCGGCGCGGGTCAACTGGCAAGTTT
TGACGATAAAGCGTTTGTGCAAGCGGGCGCTGAAATTGTAGAAGGGAATAGCGTCTGGCA
GTCAGAGATCATTCTGAAGGTCAATGCGCCGTTAGATGATGAAATTGCGTTACTGAATCC
TGGGACAACGCTGGTGAGTTTTATCTGGCCTGCGCAGAATCCGGAATTAATGCAAAAACT
TGCGGAACGTAACGTGACCGTGATGGCGATGGACTCTGTGCCGCGTATCTCACGCGCACA
ATCGCTGGACGCACTAAGCTCGATGGCGAACATCGCCGGTTATCGCGCCATTGTTGAAGC
GGCACATGAATTTGGGCGCTTCTTTACCGGGCAAATTACTGCGGCCGGGAAAGTGCCACC
GGCAAAAGTGATGGTGATTGGTGCGGGTGTTGCAGGTCTGGCCGCCATTGGCGCAGCAAA
CAGTCTCGGCGCGATTGTGCGTGCATTCGACACCCGCCCGGAAGTGAAAGAACAAGTTCA
AAGTATGGGCGCGGAATTCCTCGAGCTGGATTTTAAAGAGGAAGCTGGCAGCGGCGATGG
CTATGCCAAAGTGATGTCGGACGCGTTCATCAAAGCGGAAATGGAACTCTTTGCCGCCCA
GGCAAAAGAGGTCGATATCATTGTCACCACCGCGCTTATTCCAGGCAAACCAGCGCCGAA
GCTAATTACCCGTGAAATGGTTGACTCCATGAAGGCGGGCAGTGTGATTGTCGACCTGGC
AGCCCAAAACGGCGGCAACTGTGAATACACCGTGCCGGGTGAAATCTTCACTACGGAAAA
TGGTGTCAAAGTGATTGGTTATACCGATCTTCCGGGCCGTCTGCCGACGCAATCCTCACA
GCTTTACGGCACAAACCTCGTTAATCTGCTGAAACTGTTGTGCAAAGAGAAAGACGGCAA
TATCACTGTTGATTTTGATGATGTGGTGATTCGCGGCGTGACCGTGATCCGTGCGGGCGA
AATTACCTGGCCGGCACCGCCGATTCAGGTATCAGCTCAGCCGCAGGCGGCACAAAAAGC
GGCACCGGAAGTGAAAACTGAGGAAAAATGTACCTGCTCACCGTGGCGTAAATACGCGTT
GATGGCGCTGGCAATCATTCTTTTTGGCTGGATGGCAAGCGTTGCGCCGAAAGAATTCCT
TGGGCACTTCACCGTTTTCGCGCTGGCCTGCGTTGTCGGTTATTACGTGGTGTGGAATGT
ATCGCACGCGCTGCATACACCGTTGATGTCGGTCACCAACGCGATTTCAGGGATTATTGT
TGTCGGAGCACTGTTGCAGATTGGCCAGGGCGGCTGGGTTAGCTTCCTTAGTTTTATCGC
GGTGCTTATAGCCAGCATTAATATTTTCGGTGGCTTCACCGTGACTCAGCGCATGCTGAA
AATGTTCCGCAAAAATGGAGGGTTGGTTCCCCGTGGTAGTTCCGCTCATCACCACCATCA
TCACCATCAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  streptomycin
Bacterial Selection Condition:  streptomycin
Growth Condition:  LB with 50ug/ml streptomycin
Comments:  None
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in EC_P3_114
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: PCDF Bravo

PCDFBravo in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial expression vector with T7 promoter, N-terminal His tag and C-terminal Flag tag; ligation independent cloning (LIC) clone; streptomycin resistance in bacteria.
Comments: None
Size (bp): 3636
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Center for Structures of Membrane Proteins
PSI
William Harries
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial operon lac operator lacO 3 25
bacterial origin CloDF13 CloDF13 origin 1466 2204
gene fragment LacI LacI transcriptional represso 2417 3373
promoter T7 T7 Promoter 3621 3636
ribosome binding site RBS RBS-1: ribosome binding site 58 63
selectable marker StrepR streptomycin resistance gene 535 1326
tag His N-terminal 10xHis tag 170 199
tag Flag C-terminal Flag tag 80 103
trxn termination sequence T7 term T7 terminator 306 324

 

  • Gene
  • Protein
  • Clone
  • Experimental

Gene

Target GenBank: None

 

Clone

Cloning Information : 552373
HIP Master Clone ID : 462693
Original Clone ID : CSMP-3154

Experimental

TargetTrack - Experimental data : EC_P3_114