DNASU Plasmid Repository • 480.965.5697 | Email

HCLS1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HCLS1
Gene Name:  hematopoietic cell-specific Lyn substrate 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH026836.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00004528

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1461nts         Open reading frame : 1 to 1461
Reference Sequence Alignment

ATGTGGAAGTCTGTAGTGGGCCATGATGTGTCTGTTTCCGTGGAGACCCAGGGTGATGAT
TGGGACACAGATCCTGACTTTGTGAATGACATCTCTGAAAAGGAGCAACGATGGGGAGCC
AAGACCATCGAGGGGTCTGGACGCACAGAACACATCAACATCCACCAGCTGAGGAACAAA
GTATCAGAGGAGCATGATGTTCTCAGGAAGAAAGAGATGGAGTCAGGGCCCAAAGCATCC
CATGGCTATGGAGGTCGGTTTGGAGTAGAAAGAGACCGAATGGACAAGAGTGCAGTGGGC
CATGAGTATGTTGCCGAGGTGGAGAAGCACTCTTCTCAGACGGATGCTGCCAAAGGCTTT
GGGGGCAAGTACGGAGTTGAGAGGGACAGGGCAGACAAGTCAGCAGTCGGCTTTGATTAT
AAAGGAGAAGTGGAGAAGCATACATCTCAGAAAGATTACTCTCGTGGCTTTGGTGGCCGG
TACGGGGTGGAGAAGGATAAATGGGACAAAGCAGCTCTGGGATATGACTACAAGGGAGAG
ACGGAGAAACACGAGTCCCAGAGAGATTATGCCAAGGGCTTTGGTGGCCAGTATGGAATC
CAGAAGGACCGAGTGGATAAGAGCGCTGTCGGCTTCAATGAAATGGAGGCCCCGACCACA
GCTTATAAGAAGACGACGCCCATAGAAGCCGCTTCTAGTGGTGCCCGTGGGCTGAAGGCG
AAATTTGAGTCCATGGCTGAGGAGAAGAGGAAGCGAGAGGAAGAGGAGAAGGCACAGCAG
GTGGCCAGGAGGCAACAGGAGCGAAAGGCTGTGACAAAGAGGAGCCCTGAGGCTCCACAG
CCAGTGATAGCTATGGAAGAGCCAGCAGTACCGGCCCCACTGCCCAAGAAAATCTCCTCA
GAGGCCTGGCCTCCAGTTGGGACTCCTCCATCATCAGAGTCTGAGCCTGTGAGAACCAGC
AGGGAACACCCAGTGCCCTTGCTGCCCATTAGGCAGACTCTCCCGGAGGACAATGAGGAG
CCCCCAGCTCTGCCCCCTAGGACTCTGGAAGGCCTCCAGGTGGAGGAAGAGCCAGTGTAC
GAAGCAGAGCCTGAGCCTGAGCCCGAGCCTGAGCCCGAGCCTGAGAATGACTATGAGGAC
GTTGAGGAGATGGACAGGCATGAGCAGGAGGATGAACCAGAGGGGGACTATGAGGAGGTG
CTCGAGCCTGAAGATTCTTCTTTTTCTTCTGCTCTGGCTGGATCATCAGGCTGCCCGGCT
GGGGCTGGGGCTGGGGCTGTGGCTCTGGGGATCTCAGCTGTGGCTCTATATGATTACCAA
GGAGAGGGAAGTGATGAGCTTTCCTTTGATCCGGACGACGTAATCACTGACATTGAGATG
GTGGACGAGGGCTGGTGGCGGGGACGTTGCCATGGCCACTTTGGACTCTTCCCTGCAAAT
TATGTCAAGCTTCTGGAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1519
Start on reference sequence 59
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HCLS1
Symbol Nomenclature : HCLS1
SYNONYM : CTTNL; HS1
Designation : hematopoietic lineage cell-specific protein|lckBP1|p75
Full Nomenclature : hematopoietic cell-specific Lyn substrate 1
GENEID : 3059
GI : 60653810
GenBank Accession : AY892681
HGNC : 4844
MIM : 601306
Vega : OTTHUMG00000159409
Target GenBank: BC016758

 

Reference Sequence Alignment

  

HsCD00004528      ATGTGGAAGTCTGTAGTGGGCCATGATGTGTCTGTTTCCGTGGAGACCCAGGGTGATGAT
NM_005335.4       ATGTGGAAGTCTGTAGTGGGCCATGATGTGTCTGTTTCCGTGGAGACCCAGGGTGATGAT
                  ************************************************************

HsCD00004528      TGGGACACAGATCCTGACTTTGTGAATGACATCTCTGAAAAGGAGCAACGATGGGGAGCC
NM_005335.4       TGGGACACAGATCCTGACTTTGTGAATGACATCTCTGAAAAGGAGCAACGATGGGGAGCC
                  ************************************************************

HsCD00004528      AAGACCATCGAGGGGTCTGGACGCACAGAACACATCAACATCCACCAGCTGAGGAACAAA
NM_005335.4       AAGACCATCGAGGGGTCTGGACGCACAGAACACATCAACATCCACCAGCTGAGGAACAAA
                  ************************************************************

HsCD00004528      GTATCAGAGGAGCATGATGTTCTCAGGAAGAAAGAGATGGAGTCAGGGCCCAAAGCATCC
NM_005335.4       GTATCAGAGGAGCATGATGTTCTCAGGAAGAAAGAGATGGAGTCAGGGCCCAAAGCATCC
                  ************************************************************

HsCD00004528      CATGGCTATGGAGGTCGGTTTGGAGTAGAAAGAGACCGAATGGACAAGAGTGCAGTGGGC
NM_005335.4       CATGGCTATGGAGGTCGGTTTGGAGTAGAAAGAGACCGAATGGACAAGAGTGCAGTGGGC
                  ************************************************************

HsCD00004528      CATGAGTATGTTGCCGAGGTGGAGAAGCACTCTTCTCAGACGGATGCTGCCAAAGGCTTT
NM_005335.4       CATGAGTATGTTGCCGAGGTGGAGAAGCACTCTTCTCAGACGGATGCTGCCAAAGGCTTT
                  ************************************************************

HsCD00004528      GGGGGCAAGTACGGAGTTGAGAGGGACAGGGCAGACAAGTCAGCAGTCGGCTTTGATTAT
NM_005335.4       GGGGGCAAGTACGGAGTTGAGAGGGACAGGGCAGACAAGTCAGCAGTCGGCTTTGATTAT
                  ************************************************************

HsCD00004528      AAAGGAGAAGTGGAGAAGCATACATCTCAGAAAGATTACTCTCGTGGCTTTGGTGGCCGG
NM_005335.4       AAAGGAGAAGTGGAGAAGCACACATCTCAGAAAGATTACTCTCGTGGCTTTGGTGGCCGG
                  ******************** ***************************************

HsCD00004528      TACGGGGTGGAGAAGGATAAATGGGACAAAGCAGCTCTGGGATATGACTACAAGGGAGAG
NM_005335.4       TACGGGGTGGAGAAGGATAAATGGGACAAAGCAGCTCTGGGATATGACTACAAGGGAGAG
                  ************************************************************

HsCD00004528      ACGGAGAAACACGAGTCCCAGAGAGATTATGCCAAGGGCTTTGGTGGCCAGTATGGAATC
NM_005335.4       ACGGAGAAACACGAGTCCCAGAGAGATTATGCCAAGGGCTTTGGTGGCCAGTATGGAATC
                  ************************************************************

HsCD00004528      CAGAAGGACCGAGTGGATAAGAGCGCTGTCGGCTTCAATGAAATGGAGGCCCCGACCACA
NM_005335.4       CAGAAGGACCGAGTGGATAAGAGCGCTGTCGGCTTCAATGAAATGGAGGCCCCGACCACA
                  ************************************************************

HsCD00004528      GCTTATAAGAAGACGACGCCCATAGAAGCCGCTTCTAGTGGTGCCCGTGGGCTGAAGGCG
NM_005335.4       GCTTATAAGAAGACGACGCCCATAGAAGCCGCTTCTAGTGGTACCCGTGGGCTGAAGGCG
                  ******************************************.*****************

HsCD00004528      AAATTTGAGTCCATGGCTGAGGAGAAGAGGAAGCGAGAGGAAGAGGAGAAGGCACAGCAG
NM_005335.4       AAATTTGAGTCCATGGCTGAGGAGAAGAGGAAGCGAGAGGAAGAGGAGAAGGCACAGCAG
                  ************************************************************

HsCD00004528      GTGGCCAGGAGGCAACAGGAGCGAAAGGCTGTGACAAAGAGGAGCCCTGAGGCTCCACAG
NM_005335.4       GTGGCCAGGAGGCAACAGGAGCGAAAGGCTGTGACAAAGAGGAGCCCTGAGGCTCCACAG
                  ************************************************************

HsCD00004528      CCAGTGATAGCTATGGAAGAGCCAGCAGTACCGGCCCCACTGCCCAAGAAAATCTCCTCA
NM_005335.4       CCAGTGATAGCTATGGAAGAGCCAGCAGTACCGGCCCCACTGCCCAAGAAAATCTCCTCA
                  ************************************************************

HsCD00004528      GAGGCCTGGCCTCCAGTTGGGACTCCTCCATCATCAGAGTCTGAGCCTGTGAGAACCAGC
NM_005335.4       GAGGCCTGGCCTCCAGTTGGGACTCCTCCATCATCAGAGTCTGAGCCTGTGAGAACCAGC
                  ************************************************************

HsCD00004528      AGGGAACACCCAGTGCCCTTGCTGCCCATTAGGCAGACTCTCCCGGAGGACAATGAGGAG
NM_005335.4       AGGGAACACCCAGTGCCCTTGCTGCCCATTAGGCAGACTCTCCCGGAGGACAATGAGGAG
                  ************************************************************

HsCD00004528      CCCCCAGCTCTGCCCCCTAGGACTCTGGAAGGCCTCCAGGTGGAGGAAGAGCCAGTGTAC
NM_005335.4       CCCCCAGCTCTGCCCCCTAGGACTCTGGAAGGCCTCCAGGTGGAGGAAGAGCCAGTGTAC
                  ************************************************************

HsCD00004528      GAAGCAGAGCCTGAGCCTGAGCCCGAGCCTGAGCCCGAGCCTGAGAATGACTATGAGGAC
NM_005335.4       GAAGCAGAGCCTGAGCCTGAGCCCGAGCCTGAGCCCGAGCCTGAGAATGACTATGAGGAC
                  ************************************************************

HsCD00004528      GTTGAGGAGATGGACAGGCATGAGCAGGAGGATGAACCAGAGGGGGACTATGAGGAGGTG
NM_005335.4       GTTGAGGAGATGGACAGGCATGAGCAGGAGGATGAACCAGAGGGGGACTATGAGGAGGTG
                  ************************************************************

HsCD00004528      CTCGAGCCTGAAGATTCTTCTTTTTCTTCTGCTCTGGCTGGATCATCAGGCTGCCCGGCT
NM_005335.4       CTCGAGCCTGAAGATTCTTCTTTTTCTTCTGCTCTGGCTGGATCATCAGGCTGCCCGGCT
                  ************************************************************

HsCD00004528      GGGGCTGGGGCTGGGGCTGTGGCTCTGGGGATCTCAGCTGTGGCTCTATATGATTACCAA
NM_005335.4       GGGGCTGGGGCTGGGGCTGTGGCTCTGGGGATCTCAGCTGTGGCTCTATATGATTACCAA
                  ************************************************************

HsCD00004528      GGAGAGGGAAGTGATGAGCTTTCCTTTGATCCGGACGACGTAATCACTGACATTGAGATG
NM_005335.4       GGAGAGGGAAGTGATGAGCTTTCCTTTGATCCGGACGACGTAATCACTGACATTGAGATG
                  ************************************************************

HsCD00004528      GTGGACGAGGGCTGGTGGCGGGGACGTTGCCATGGCCACTTTGGACTCTTCCCTGCAAAT
NM_005335.4       GTGGACGAGGGCTGGTGGCGGGGACGTTGCCATGGCCACTTTGGACTCTTCCCTGCAAAT
                  ************************************************************

HsCD00004528      TATGTCAAGCTTCTGGAGTTG
NM_005335.4       TATGTCAAGCTTCTGGAGTGA
                  ******************* .

Pathways

NCI : Fc-epsilon receptor I signaling in mast cells
WikiPathway : B Cell Receptor Signaling Pathway

Protein

SMART domain : SH3 : Src homology 3 domains
UniProt : P14317
HPRD : 03199

Clone

Cloning Information : 26836
HIP Master Clone ID : 57212
Original Clone ID : FLH026836.01L

Organism


TAX_ID : 9606
Species Specific ID: 3059

Genome

Chromosome : 3
Map Location : 3q13
Ensembl : ENSG00000180353

Reagents

Labome : HCLS1-antibody