DNASU Plasmid Repository • 480.965.5697 | Email

SDC1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SDC1
Gene Name:  syndecan 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH195761.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00045282

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 933nts         Open reading frame : 1 to 933
Reference Sequence Alignment

ATGAGGCGCGCGGCGCTCTGGCTCTGGCTGTGCGCGCTGGCGCTGAGCCTGCAGCCGGCC
CTGCCGCAAATTGTGGCTACTAATTTGCCCCCTGAAGATCAAGATGGCTCTGGGGATGAC
TCTGACAACTTCTCCGGCTCAGGTGCAGGTGCTTTGCAAGATATCACCTTGTCACAGCAG
ACCCCCTCCACTTGGAAGGACACGCAGCTCCTGACGGCTATTCCCACGTCTCCAGAACCC
ACCGGCCTGGAGGCTACAGCTGCCTCCACCTCCACCCTGCCGGCTGGAGAGGGGCCCAAG
GAGGGAGAGGCTGTAGTCCTGCCAGAAGTGGAGCCTGGCCTCACCGCCCGGGAGCAGGAG
GCCACCCCCCGACCCAGGGAGACCACACAGCTCCCGACCACTCATCAGGCCTCAACGACC
ACAGCCACCACGGCCCAGGAGCCCGCCACCTCCCACCCCCACAGGGACATGCAGCCTGGC
CACCATGAGACCTCAACCCCTGCAGGACCCAGCCAAGCTGACCTTCACACTCCCCACACA
GAGGATGGAGGTCCTTCTGCCACCGAGAGGGCTGCTGAGGATGGAGCCTCCAGTCAGCTC
CCAGCAGCAGAGGGCTCTGGGGAGCAGGACTTCACCTTTGAAACCTCGGGGGAGAATACG
GCTGTAGTGGCCGTGGAGCCTGACCGCCGGAACCAGTCCCCAGTGGATCAGGGGGCCACG
GGGGCCTCACAGGGCCTCCTGGACAGGAAAGAGGTGCTGGGAGGGGTCATTGCCGTAGGC
CTCGTGGGGCTCATCTTTGCTGTGTGCCTGGTGGGTTTCATGCTGTACCGCATGAAGAAG
AAGGACGAAGGCAGCTACTCCTTGGAGGAGCCGAAACAAGCCAACGGCGGGGCCTACCAG
AAGCCCACCAAACAGGAGGAATTCTATGCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1185
Start on reference sequence 253
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SDC1
Symbol Nomenclature : SDC1
SYNONYM : CD138; SDC; SYND1; syndecan
Designation : CD138 antigen|heparan sulfate proteoglycan fibroblast growth factor receptor|syndecan proteoglycan 1|syndecan-1
Full Nomenclature : syndecan 1
GENEID : 6382
HGNC : 10658
MIM : 186355
Vega : OTTHUMG00000090751
Target GenBank: BC008765

 

Reference Sequence Alignment

  

HsCD00045282        ATGAGGCGCGCGGCGCTCTGGCTCTGGCTGTGCGCGCTGGCGCTGAGCCTGCAGCCGGCC
XM_005262622.1      ------------------------------------------------------ATGGGA
XM_005262621.1      ---------------ATGACTGTTTATTGTAGATGGGCCATGGTGGACTGTGACTGTTCA
NM_002997.4         ATGAGGCGCGCGGCGCTCTGGCTCTGGCTGTGCGCGCTGGCGCTGAGCCTGCAGCCGGCC
NM_001006946.1      ATGAGGCGCGCGGCGCTCTGGCTCTGGCTGTGCGCGCTGGCGCTGAGCCTGCAGCCGGCC
                                                                               .

HsCD00045282        CTGCCGCAAATTGTGGCTACTAATTTGCCCCCTGAAGATCAAGATGGCTCTGGGGATGAC
XM_005262622.1      GATGAGCAAATTGTGGCTACTAATTTGCCCCCTGAAGATCAAGATGGCTCTGGGGATGAC
XM_005262621.1      TTGCAGCAAATTGTGGCTACTAATTTGCCCCCTGAAGATCAAGATGGCTCTGGGGATGAC
NM_002997.4         CTGCCGCAAATTGTGGCTACTAATTTGCCCCCTGAAGATCAAGATGGCTCTGGGGATGAC
NM_001006946.1      CTGCCGCAAATTGTGGCTACTAATTTGCCCCCTGAAGATCAAGATGGCTCTGGGGATGAC
                     :  .*******************************************************

HsCD00045282        TCTGACAACTTCTCCGGCTCAGGTGCAGGTGCTTTGCAAGATATCACCTTGTCACAGCAG
XM_005262622.1      TCTGACAACTTCTCCGGCTCAGGTGCAGGTGCTTTGCAAGATATCACCTTGTCACAGCAG
XM_005262621.1      TCTGACAACTTCTCCGGCTCAGGTGCAGGTGCTTTGCAAGATATCACCTTGTCACAGCAG
NM_002997.4         TCTGACAACTTCTCCGGCTCAGGTGCAGGTGCTTTGCAAGATATCACCTTGTCACAGCAG
NM_001006946.1      TCTGACAACTTCTCCGGCTCAGGTGCAGGTGCTTTGCAAGATATCACCTTGTCACAGCAG
                    ************************************************************

HsCD00045282        ACCCCCTCCACTTGGAAGGACACGCAGCTCCTGACGGCTATTCCCACGTCTCCAGAACCC
XM_005262622.1      ACCCCCTCCACTTGGAAGGACACGCAGCTCCTGACGGCTATTCCCACGTCTCCAGAACCC
XM_005262621.1      ACCCCCTCCACTTGGAAGGACACGCAGCTCCTGACGGCTATTCCCACGTCTCCAGAACCC
NM_002997.4         ACCCCCTCCACTTGGAAGGACACGCAGCTCCTGACGGCTATTCCCACGTCTCCAGAACCC
NM_001006946.1      ACCCCCTCCACTTGGAAGGACACGCAGCTCCTGACGGCTATTCCCACGTCTCCAGAACCC
                    ************************************************************

HsCD00045282        ACCGGCCTGGAGGCTACAGCTGCCTCCACCTCCACCCTGCCGGCTGGAGAGGGGCCCAAG
XM_005262622.1      ACCGGCCTGGAGGCTACAGCTGCCTCCACCTCCACCCTGCCGGCTGGAGAGGGGCCCAAG
XM_005262621.1      ACCGGCCTGGAGGCTACAGCTGCCTCCACCTCCACCCTGCCGGCTGGAGAGGGGCCCAAG
NM_002997.4         ACCGGCCTGGAGGCTACAGCTGCCTCCACCTCCACCCTGCCGGCTGGAGAGGGGCCCAAG
NM_001006946.1      ACCGGCCTGGAGGCTACAGCTGCCTCCACCTCCACCCTGCCGGCTGGAGAGGGGCCCAAG
                    ************************************************************

HsCD00045282        GAGGGAGAGGCTGTAGTCCTGCCAGAAGTGGAGCCTGGCCTCACCGCCCGGGAGCAGGAG
XM_005262622.1      GAGGGAGAGGCTGTAGTCCTGCCAGAAGTGGAGCCTGGCCTCACCGCCCGGGAGCAGGAG
XM_005262621.1      GAGGGAGAGGCTGTAGTCCTGCCAGAAGTGGAGCCTGGCCTCACCGCCCGGGAGCAGGAG
NM_002997.4         GAGGGAGAGGCTGTAGTCCTGCCAGAAGTGGAGCCTGGCCTCACCGCCCGGGAGCAGGAG
NM_001006946.1      GAGGGAGAGGCTGTAGTCCTGCCAGAAGTGGAGCCTGGCCTCACCGCCCGGGAGCAGGAG
                    ************************************************************

HsCD00045282        GCCACCCCCCGACCCAGGGAGACCACACAGCTCCCGACCACTCATCAGGCCTCAACGACC
XM_005262622.1      GCCACCCCCCGACCCAGGGAGACCACACAGCTCCCGACCACTCATCTGGCCTCAACGACC
XM_005262621.1      GCCACCCCCCGACCCAGGGAGACCACACAGCTCCCGACCACTCATCTGGCCTCAACGACC
NM_002997.4         GCCACCCCCCGACCCAGGGAGACCACACAGCTCCCGACCACTCATCAGGCCTCAACGACC
NM_001006946.1      GCCACCCCCCGACCCAGGGAGACCACACAGCTCCCGACCACTCATCAGGCCTCAACGACC
                    **********************************************:*************

HsCD00045282        ACAGCCACCACGGCCCAGGAGCCCGCCACCTCCCACCCCCACAGGGACATGCAGCCTGGC
XM_005262622.1      ACAGCCACCACGGCCCAGGAGCCCGCCACCTCCCACCCCCACAGGGACATGCAGCCTGGC
XM_005262621.1      ACAGCCACCACGGCCCAGGAGCCCGCCACCTCCCACCCCCACAGGGACATGCAGCCTGGC
NM_002997.4         ACAGCCACCACGGCCCAGGAGCCCGCCACCTCCCACCCCCACAGGGACATGCAGCCTGGC
NM_001006946.1      ACAGCCACCACGGCCCAGGAGCCCGCCACCTCCCACCCCCACAGGGACATGCAGCCTGGC
                    ************************************************************

HsCD00045282        CACCATGAGACCTCAACCCCTGCAGGACCCAGCCAAGCTGACCTTCACACTCCCCACACA
XM_005262622.1      CACCATGAGACCTCAACCCCTGCAGGACCCAGCCAAGCTGACCTTCACACTCCCCACACA
XM_005262621.1      CACCATGAGACCTCAACCCCTGCAGGACCCAGCCAAGCTGACCTTCACACTCCCCACACA
NM_002997.4         CACCATGAGACCTCAACCCCTGCAGGACCCAGCCAAGCTGACCTTCACACTCCCCACACA
NM_001006946.1      CACCATGAGACCTCAACCCCTGCAGGACCCAGCCAAGCTGACCTTCACACTCCCCACACA
                    ************************************************************

HsCD00045282        GAGGATGGAGGTCCTTCTGCCACCGAGAGGGCTGCTGAGGATGGAGCCTCCAGTCAGCTC
XM_005262622.1      GAGGATGGAGGTCCTTCTGCCACCGAGAGGGCTGCTGAGGATGGAGCCTCCAGTCAGCTC
XM_005262621.1      GAGGATGGAGGTCCTTCTGCCACCGAGAGGGCTGCTGAGGATGGAGCCTCCAGTCAGCTC
NM_002997.4         GAGGATGGAGGTCCTTCTGCCACCGAGAGGGCTGCTGAGGATGGAGCCTCCAGTCAGCTC
NM_001006946.1      GAGGATGGAGGTCCTTCTGCCACCGAGAGGGCTGCTGAGGATGGAGCCTCCAGTCAGCTC
                    ************************************************************

HsCD00045282        CCAGCAGCAGAGGGCTCTGGGGAGCAGGACTTCACCTTTGAAACCTCGGGGGAGAATACG
XM_005262622.1      CCAGCAGCAGAGGGCTCTGGGGAGCAGGACTTCACCTTTGAAACCTCGGGGGAGAATACG
XM_005262621.1      CCAGCAGCAGAGGGCTCTGGGGAGCAGGACTTCACCTTTGAAACCTCGGGGGAGAATACG
NM_002997.4         CCAGCAGCAGAGGGCTCTGGGGAGCAGGACTTCACCTTTGAAACCTCGGGGGAGAATACG
NM_001006946.1      CCAGCAGCAGAGGGCTCTGGGGAGCAGGACTTCACCTTTGAAACCTCGGGGGAGAATACG
                    ************************************************************

HsCD00045282        GCTGTAGTGGCCGTGGAGCCTGACCGCCGGAACCAGTCCCCAGTGGATCAGGGGGCCACG
XM_005262622.1      GCTGTAGTGGCCGTGGAGCCTGACCGCCGGAACCAGTCCCCAGTGGATCAGGGGGCCACG
XM_005262621.1      GCTGTAGTGGCCGTGGAGCCTGACCGCCGGAACCAGTCCCCAGTGGATCAGGGGGCCACG
NM_002997.4         GCTGTAGTGGCCGTGGAGCCTGACCGCCGGAACCAGTCCCCAGTGGATCAGGGGGCCACG
NM_001006946.1      GCTGTAGTGGCCGTGGAGCCTGACCGCCGGAACCAGTCCCCAGTGGATCAGGGGGCCACG
                    ************************************************************

HsCD00045282        GGGGCCTCACAGGGCCTCCTGGACAGGAAAGAGGTGCTGGGAGGGGTCATTGCCGTAGGC
XM_005262622.1      GGGGCCTCACAGGGCCTCCTGGACAGGAAAGAGGTGCTGGGAGGGGTCATTGCCGGAGGC
XM_005262621.1      GGGGCCTCACAGGGCCTCCTGGACAGGAAAGAGGTGCTGGGAGGGGTCATTGCCGGAGGC
NM_002997.4         GGGGCCTCACAGGGCCTCCTGGACAGGAAAGAGGTGCTGGGAGGGGTCATTGCCGGAGGC
NM_001006946.1      GGGGCCTCACAGGGCCTCCTGGACAGGAAAGAGGTGCTGGGAGGGGTCATTGCCGGAGGC
                    ******************************************************* ****

HsCD00045282        CTCGTGGGGCTCATCTTTGCTGTGTGCCTGGTGGGTTTCATGCTGTACCGCATGAAGAAG
XM_005262622.1      CTCGTGGGGCTCATCTTTGCTGTGTGCCTGGTGGGTTTCATGCTGTACCGCATGAAGAAG
XM_005262621.1      CTCGTGGGGCTCATCTTTGCTGTGTGCCTGGTGGGTTTCATGCTGTACCGCATGAAGAAG
NM_002997.4         CTCGTGGGGCTCATCTTTGCTGTGTGCCTGGTGGGTTTCATGCTGTACCGCATGAAGAAG
NM_001006946.1      CTCGTGGGGCTCATCTTTGCTGTGTGCCTGGTGGGTTTCATGCTGTACCGCATGAAGAAG
                    ************************************************************

HsCD00045282        AAGGACGAAGGCAGCTACTCCTTGGAGGAGCCGAAACAAGCCAACGGCGGGGCCTACCAG
XM_005262622.1      AAGGACGAAGGCAGCTACTCCTTGGAGGAGCCGAAACAAGCCAACGGCGGGGCCTACCAG
XM_005262621.1      AAGGACGAAGGCAGCTACTCCTTGGAGGAGCCGAAACAAGCCAACGGCGGGGCCTACCAG
NM_002997.4         AAGGACGAAGGCAGCTACTCCTTGGAGGAGCCGAAACAAGCCAACGGCGGGGCCTACCAG
NM_001006946.1      AAGGACGAAGGCAGCTACTCCTTGGAGGAGCCGAAACAAGCCAACGGCGGGGCCTACCAG
                    ************************************************************

HsCD00045282        AAGCCCACCAAACAGGAGGAATTCTATGCCTAG
XM_005262622.1      AAGCCCACCAAACAGGAGGAATTCTATGCCTGA
XM_005262621.1      AAGCCCACCAAACAGGAGGAATTCTATGCCTGA
NM_002997.4         AAGCCCACCAAACAGGAGGAATTCTATGCCTGA
NM_001006946.1      AAGCCCACCAAACAGGAGGAATTCTATGCCTGA
                    *******************************..

Pathways

NCI : Beta3 integrin cell surface interactions
NCI : Beta5 beta6 beta7 and beta8 integrin cell surface interactions
NCI : Integrins in angiogenesis
NCI : Proteoglycan syndecan-mediated signaling events
NCI : Syndecan-1-mediated signaling events
Reactome : A tetrasaccharide linker sequence is required for GAG synthesis
Reactome : Chondroitin sulfate/dermatan sulfate metabolism
Reactome : Chylomicron-mediated lipid transport
Reactome : Disease
Reactome : Diseases associated with visual transduction
Reactome : Extracellular matrix organization
Reactome : Glycogen storage diseases
Reactome : Glycosaminoglycan metabolism
Reactome : HS-GAG biosynthesis
Reactome : HS-GAG degradation
Reactome : Heparan sulfate/heparin (HS-GAG) metabolism
Reactome : Lipid digestion, mobilization, and transport
Reactome : Lipoprotein metabolism
Reactome : MPS I - Hurler syndrome
Reactome : MPS II - Hunter syndrome
Reactome : MPS IIIA - Sanfilippo syndrome A
Reactome : MPS IIIB - Sanfilippo syndrome B
Reactome : MPS IIIC - Sanfilippo syndrome C
Reactome : MPS IIID - Sanfilippo syndrome D
Reactome : MPS IV - Morquio syndrome A
Reactome : MPS IV - Morquio syndrome B
Reactome : MPS IX - Natowicz syndrome
Reactome : MPS VI - Maroteaux-Lamy syndrome
Reactome : MPS VII - Sly syndrome
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Metabolism of lipids and lipoproteins
Reactome : Mucopolysaccharidoses
Reactome : Myoclonic epilepsy of Lafora
Reactome : Non-integrin membrane-ECM interactions
Reactome : Retinoid metabolism and transport
Reactome : Signal Transduction
Reactome : Syndecan interactions
Reactome : Visual phototransduction

Protein

SMART domain : 4.1m : putative band 4.1 homologues binding motif
UniProt : P18827
HPRD : 01718

Clone

Cloning Information : 195761
HIP Master Clone ID : 170472
Original Clone ID : FLH195761.01X

Organism


TAX_ID : 9606
Species Specific ID: 6382

Genome

Chromosome : 2
Map Location : 2p24.1
Ensembl : ENSG00000115884

Reagents

Labome : syndecan-antibody