DNASU Plasmid Repository • 480.965.2857 | Email

celA (Streptococcus mutans UA159) in pMCSG7 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  bgl
Gene Name:  6-phospho-beta-glucosidase
Sequence             
Original Clone ID: APC100193.104
Keyword: None
Species: Streptococcus mutans UA159
Type: cDNA
Vector Name: pMCSG7               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 23519420
Title: GH1-family 6-P-Beta-glucosidases from human microbiome lactic acid bacteria.
Authors: Midwest Center for Structural Genomics
Jessica Bearden
PSI:Biology
SmCD00454274

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1434nts         Open reading frame : 42 to 1475

TAGATCTGGGTACCGAGAACCTGTACTTCCAATCCAATGCCATGTCTAAATTACCTGAAA
ATTTTCTCTGGGGCGGTGCGGTTGCTGCCCATCAGCTAGAAGGCGGTTGGCAAGAAGGAG
GCAAGGGAATTTCTGTTGCTGATGTCATGACTGCTGGTCGGCACGGCGTTGCGCGTGAAA
TCACAGCCGGTGTTCTAGAAGGTAAGTATTATCCTAACCATGAAGCCATTGATTTTTATC
ATCACTATAAAGAAGATGTCAAATTGTTTGCCGAAATGGGCTTCAAATGTTTTCGGACTT
CCATCGCTTGGACACGGATTTTTCCTAAGGGAGATGAAGCAGAGCCTAATGAAGCAGGTC
TGCAATTTTATGATGACCTTTTTGATGAATGTCTGAAATATGGTATTGAACCCGTTGTGA
CCCTATCGCATTTTGAATTGCCTTATCACCTTGTTACCGAATATGGTGGCTTTACTAACC
GAAAAGTAATTGATTTCTTTGTTCATTTTGCTGAAGTTTGCTTTCGTCGTTATAAGGATA
AGGTTAAGTATTGGATGACTTTCAACGAAATCAATAACCAAGCCAATTATCAAGAAGATT
TTGCACCTTTTACTAATTCGGGGATTGTTTACAAAGAGGGAGATGACCGCGAAGCGATTA
TGTACCAAGCTGCTCATTATGAACTGGTAGCTTCTGCGCGTGCCGTTAAAATTGGTCATG
CGATTAATCCCAATCTCAATATTGGGTGCATGGTTGCCATGTGTCCAATTTATCCAGCAA
CCTGTAACCCTAAAGATATCCTCATGGCTCAAAAAGCTATGCAAAAGCGTTATTACTTTG
CGGATGTTCATGTCCATGGTTTTTATCCAGAACATATTTTCAAGTATTGGGAACGCAAGG
CTATTAAGGTTGATTTTACTGAGCGAGATAAGAAGGATTTGTTTGAAGGAACGGTAGATT
ACATCGGCTTTTCATATTACATGTCCTTTGTCATTGATGCTCACCGTGAAAATAATCCTT
ACTATGATTATCTAGAAACAGAAGATTTAGTTAAAAATCCTTATGTAAAGGCTTCTGACT
GGGATTGGCAAATAGATCCTCAAGGTTTGCGTTATGCTCTCAATTGGTTTACTGACATGT
ATCATTTACCGCTTTTCATTGTTGAGAATGGCTTTGGAGCCATTGATCAAGTTGAAGCTG
ATGGCATGGTTCACGACGATTATCGGATTGATTATCTGGGTGCTCATATCAAGGAGATGA
TTAAGGCTGTTGATGAAGATGGCGTTGAGCTCATGGGCTATACACCTTGGGGATGTATTG
ATCTGGTTTCAGCAGGAACAGGTGAAATGCGCAAGCGCTACGGTTTTATTTATGTTGATA
AGGACGATGAAGGCAAGGGAACCCTCAAACGTTCACCAAAATTATCATTCAATTGGTATA
AAGAAGTCATTGCTTCAAATGGAGATGACATTTAATAACATTGGAAGTGGATAACGGATC
CGAATTCGAGCTCCGT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in MCSG-APC100193
Recommended expression in: E.coli BL21 (DE3)
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG7

pMCSG7 in advanced viewed

Synonyms: pMCSG-7
Sequencing Primer: Forward:  T7short
Reverse:  T7 terminator
Description: Bacterial expresson vector with T7 promoter, adds N-terminal His tag and TEV protease site; amp resistance; ligation independent cloning (LIC).
Comments: pET21 derivative; for routine HTP purification
Size (bp): 5286
Parent Vector: None
Empty Vector: EvNO00084271
Properties: bacterial expression, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 12071693
Title: A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC ligation-independent cloning (LIC) region 204 235
bacterial origin ori ColE1 pBR322-type bacterial origin of replication 3280 3280
promoter T7 T7 promoter 360 376
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 335 357
repressor protein gene LacI LacI coding region 890 1849
selectable marker AmpR ampicillin resistance gene 4038 4898
tag His 2 N-terminal 6xHis tag 268 285
tag His C-terminal 6xHis tag 140 157
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : bgl
SYNONYM : SMU.1601
GENEID : 1028834
Locus Tag : SMU_1601
GI : 24379982
Target GenBank: None

 

Protein

PDB - Structural Annotation : 4DDE
PDB - Structural Annotation : 4F66
PDB - Structural Annotation : 4F79
PDB - Structural Annotation : 4GPN
PDB - Structural Annotation : 3PN8
Structural Annotation Wiki : TOPSAN
Structural Annotation Wiki : MCSG-APC100193
Protein Structure Viewer

FirstGlance in Jmol
PDB ID

Style



Color





Clone

Cloning Information : 583517
HIP Master Clone ID : 486446
Original Clone ID : APC100193.104

Experimental

Structural Biology Knowledgebase : SBKB (4DDE)
Structural Biology Knowledgebase : SBKB (4F79)
Structural Biology Knowledgebase : SBKB (3PN8)
Structural Biology Knowledgebase : SBKB (4GPN)
Structural Biology Knowledgebase : SBKB (4F66)
TargetTrack - Experimental data : MCSG-APC100193

Organism


TAX_ID : 210007
Species Specific ID: 1028834

Reagents

Labome : bgl-cDNA