DNASU Plasmid Repository • 480.965.5697 | Email

Aaci_2525 (A. acidocaldarius subsp. acidocaldarius DSM 446 ) in pMCSG48

TOP

Explanation of Terms


Gene: Gene Symbol:  Aaci_2525
Gene Name:  PAS modulated Fis family sigma-54-specific transcriptional regulator
Sequence             
Original Clone ID: APC101014.106
Keyword: None
Species: Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446
Type: cDNA
Vector Name: pMCSG48               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: Midwest Center for Structural Genomics
Argonne National Laboratory
PSI:Biology
Shonda Clancy
AaCD00454434

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1335nts         Open reading frame : 51 to 1385

CGCGTATGGCGCCGTATACAACACGAGAACCTGTACTTCCATCCAATGCCATGCCGGGCG
AGATCGCGCGGACATCCGACCTTCAATCCGACATCGTCCTGCGCGCGCTGCTTGACGTCG
TGGATGACGCGGTGACCGTGGTCGATCGCGCCGGGACCGTCGTCGCATGGAACCGAGCGG
CCGAGGCGCTGTACGGGATCCCCGCGGAGGACATCGTCGGGCGCCCCATCACCGACTTCT
TCGCCCTCGAATCCCTCGCCGTGCACAGCGTCCTCACCACCGGCGCGCACATCGACCATG
CGTACCACCGCCCGCGCCCCGACGTGCACGTCCTCATCTCCGCGGCGCCGGTGCAAGACG
AACATGGAGAGATTGCCGGCGCCATCGCCGTCGAGCGGGACATGACTGTGCTCGTCCGCA
TGGGAGAGGAGAACGCGCGCCATCTGGTCCAGGCGCAAGGCGACATGCTGCGGACGCAGA
CGGTCGATCGCGTCCTCAACACCCTGACCGCCCCAGGCAGGCCGAGGCACGCGCTCGTGG
TCGGCGCCCGCGGCACGGGCAAGCGCACCGTCGCGGAAGCATCCCATCGCCTGCTTCGGC
TCCAGGGTCCGTTTCTCGCCGTGCGCGCCGAGCCTCGCGCCGCGGCCCTGATGGACGTCG
CGCTCTTTGGTGCGGACGGATCGCTCGTCTTGTCTCCTGAAGCTCGTCGCGAAGGATGGA
TCGAGCGAGCCGCCGGCGGCACGCTCCTGCTTCAGGACGCGCACCTCATGCCAAGCGCGG
TGCAGGCGAAACTCGCCGCGGCCATCGAGGAGCATTGGTTTCGGCCGCTCGGCGGCCATC
GGGACCTTCCCCTCCGGTGCCGCATCCTCGCCACCGCGCCCACGGCGGACGCGGTCGATC
CGGCCCTTGCCCGCGCGCTCCCGATGGTCGAACTCCCGCCCATCGCCGAGCGGCGAGACG
AAAGCCTGCTTCTGTTCCACTTCTGGCTCACGCGTTGGGCCAAGGAGCGAGGGGCCATCC
CACCGCGCGTGTCGGAGGAGGCGGCTGGATTGATCCAAGCCTATGCATGGCCTGGAAATA
TCGAGGAGATTGTGCAGGCGGCGCGGAGGACGCTGTCGATGGCGGAGGGCGAAGTGCGGC
CTGAGCATCTGCCCGAGGCGGTGCGGGCCCTGCACCTGAAGCCGGCGCGGCGCCGCGTGC
CGCTGGCCGATCAATCGAAGGAGTTGGAGCGCGCGCGCATCCGCGAGGCGCTCGAGGAAT
CCGGCGGAAACAAATCGCGCGCCGCCCAGTTGCTCGGCATCTCGAGGGCGGCGCTCTACT
ACAAGCTGAAGCAGCACGGCATGGATGACGTCACGCGATCCCGTCGACCAGCTTCCCGGG
GTTAACATTGGAAGTGGATAATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
c63t,L21L
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in MCSG-APC101014
Recommended expression in: E.coli BL21 (DE3)
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG48

pMCSG48 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pMCSG48F
Reverse:  T7 terminator
Description: Bacterial expression vector with a T7 promoter and N-terminal 8xHis NusA tag, TEV cleavable; ampicillin resistance in bacteria; Ligation Independent cloning
Comments: None
Size (bp): 6741
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Midwest Center for Structural Genomics
PSI:Biology
Publications: None
Vector Map:         Vector Sequence:
Sequence: Not Available

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 origin of replication 4735 4735
gene fragment NusA NusA cds 252 1710
ligation independent cloning LIC LIC site 205 234
primer forward primer Forward sequencing primer GAAGGGTTGACCGACGAAAAAGC 0 0
promoter T7 T7 promoter 2345 3304
protease cleavage site TEV TEV protease cleavage site 223 243
repressor protein gene LacI LacI cds 2345 3304
selectable marker AmpR Ampicillin resistance gene 5493 6353
tag His N-terminal 8xHis tag 1717 1740
trxn termination sequence T7 term T7 terminator 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : Aaci_2525
GENEID : 8426054
Locus Tag : Aaci_2525
GI : 257479211
Target GenBank: None

 

Protein

SMART domain : PAS : PAS domain
Structural Annotation Wiki : MCSG-APC101014
Structural Annotation Wiki : TOPSAN

Clone

Cloning Information : 583845
HIP Master Clone ID : 486774
Original Clone ID : APC101014.106

Experimental

TargetTrack - Experimental data : MCSG-APC101014

Organism


TAX_ID : 521098
Species Specific ID: 8426054

Reagents

Labome : Aaci_2525-cDNA