DNASU Plasmid Repository • 480.965.5697 | Email

SLC18A1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SLC18A1
Gene Name:  solute carrier family 18 (vesicular monoamine transporter), member 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH263529.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00045462

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1482nts         Open reading frame : 1 to 1482
Reference Sequence Alignment

ATGCTCCGGCCCATTCTGGATGCTCCCCAGCGGTTGCTGAAGGAGGGGAGAGCGTCCCGG
CAGCTGGTGCTGGTGGTGGTATTCGTCGCTTTGCTCCTGGACAACATGCTGTTTACTGTG
GTGGTGCCAATTGTGCCCACCTTCCTATATGACATGGAGTTCAAAGAAGTCAACTCTTCT
CTGCACCTCGGCCATGCCGGAAGTTCCCCACATGCCCTCGCCTCTCCTGCCTTTTCCACC
ATCTTCTCCTTCTTCAACAACAACACCGTGGCTGTTGAAGAAAGCGTACCTAGTGGAATA
GCATGGATGAATGACACTGCCAGCACCATCCCACCTCCAGCCACTGAAGCCATCTCAGCT
CATAAAAACAACTGCTTGCAAGGCACAGGTTTCTTGGAGGAAGAGACTACCCGGGTCGGG
GTTCTGTTTGCTTCAAAGGCTGTGATGCAACTTCTGGTCAACCCATTCGTGGGCCCTCTC
ACCAACAGGATTGGATATCATATCCCCATGTTTGCTGGCTTTGTTATCATGTTTCTCTCC
ACAGTTATGTTTGCTTTTTCTGGGACCTATACTCTACTCTTTGTGGCCCGAACCCTTCAA
GGCATTGGATCTTCATTTTCATCTGTTGCAGGTCTTGGAATGCTGGCCAGTGTCTACACT
GATGACCATGAGAGAGGACGAGCCATGGGAACTGCTCTGGGGGGCCTGGCCTTGGGGTTG
CTGGTGGGAGCTCCCTTTGGAAGTGTAATGTACGAGTTTGTTGGGAAGTCTGCACCCTTC
CTCATCCTGGCCTTCCTGGCACTACTGGATGGAGCACTCCAGCTTTGCATCCTACAGCCT
TCCAAAGTCTCTCCTGAGAGTGCCAAGGGGACTCCCCTCTTTATGCTTCTCAAAGACCCT
TACATCCTGGTGGCTGCAGGTCTAGCTTTCTTGCCTGCCAGTGTGTCCTACCTCATTGGC
ACCAACCTCTTTGGTGTGTTGGCCAACAAGATGGGTCGGTGGCTGTGTTCCCTAATCGGG
ATGCTGGTAGTAGGTACCAGCTTGCTCTGTGTTCCTCTGGCTCACAATATTTTTGGTCTC
ATTGGCCCCAATGCAGGGCTTGGCCTTGCCATAGGCATGGTGGATTCTTCTATGATGCCC
ATCATGGGGCACCTGGTGGATCTACGCCACACCTCGGTGTATGGGAGTGTCTACGCCATC
GCTGATGTGGCTTTTTGCATGGGCTTTGCTATAGGTCCATCCACCGGTGGTGCCATTGTA
AAGGCCATCGGTTTTCCCTGGCTCATGGTCATCACTGGGGTCATCAACATCGTCTATGCT
CCACTCTGCTACTACCTGCGGAGCCCCCCGGCAAAGGAAGAGAAGCTTGCTATTCTGAGT
CAGGACTGCCCCATGGAGACCCGGATGTATGCAACCCAGAAGCCCACGAAGGAATTTCCT
CTGGGGGAGGACAGTGATGAGGAGCCTGACCATGAGGAGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1862
Start on reference sequence 381
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SLC18A1
Symbol Nomenclature : SLC18A1
SYNONYM : CGAT; VAT1; VMAT1
Designation : chromaffin granule amine transporter|solute carrier family 18 (vesicular monoamine), member 1|solute carrier family 18 member 1|vesicular amine transporter 1
Full Nomenclature : solute carrier family 18 (vesicular monoamine transporter), member 1
GENEID : 6570
HGNC : 10934
MIM : 193002
Vega : OTTHUMG00000097017
Target GenBank: BC006317

 

Reference Sequence Alignment

  

HsCD00045462        ATGCTCCGGCCCATTCTGGATGCTCCCCAGCGGTTGCTGAAGGAGGGGAGAGCGTCCCGG
NM_001135691.2      ATGCTCCGGACCATTCTGGATGCTCCCCAGCGGTTGCTGAAGGAGGGGAGAGCGTCCCGG
NM_001142324.1      ATGCTCCGGACCATTCTGGATGCTCCCCAGCGGTTGCTGAAGGAGGGGAGAGCGTCCCGG
NM_003053.3         ATGCTCCGGACCATTCTGGATGCTCCCCAGCGGTTGCTGAAGGAGGGGAGAGCGTCCCGG
                    *********.**************************************************

HsCD00045462        CAGCTGGTGCTGGTGGTGGTATTCGTCGCTTTGCTCCTGGACAACATGCTGTTTACTGTG
NM_001135691.2      CAGCTGGTGCTGGTGGTGGTATTCGTCGCTTTGCTCCTGGACAACATGCTGTTTACTGTG
NM_001142324.1      CAGCTGGTGCTGGTGGTGGTATTCGTCGCTTTGCTCCTGGACAACATGCTGTTTACTGTG
NM_003053.3         CAGCTGGTGCTGGTGGTGGTATTCGTCGCTTTGCTCCTGGACAACATGCTGTTTACTGTG
                    ************************************************************

HsCD00045462        GTGGTGCCAATTGTGCCCACCTTCCTATATGACATGGAGTTCAAAGAAGTCAACTCTTCT
NM_001135691.2      GTGGTGCCAATTGTGCCCACCTTCCTATATGACATGGAGTTCAAAGAAGTCAACTCTTCT
NM_001142324.1      GTGGTGCCAATTGTGCCCACCTTCCTATATGACATGGAGTTCAAAGAAGTCAACTCTTCT
NM_003053.3         GTGGTGCCAATTGTGCCCACCTTCCTATATGACATGGAGTTCAAAGAAGTCAACTCTTCT
                    ************************************************************

HsCD00045462        CTGCACCTCGGCCATGCCGGAAGTTCCCCACATGCCCTCGCCTCTCCTGCCTTTTCCACC
NM_001135691.2      CTGCACCTCGGCCATGCCGGAAGTTCCCCACATGCCCTCGCCTCTCCTGCCTTTTCCACC
NM_001142324.1      CTGCACCTCGGCCATGCCGGAAGTTCCCCACATGCCCTCGCCTCTCCTGCCTTTTCCACC
NM_003053.3         CTGCACCTCGGCCATGCCGGAAGTTCCCCACATGCCCTCGCCTCTCCTGCCTTTTCCACC
                    ************************************************************

HsCD00045462        ATCTTCTCCTTCTTCAACAACAACACCGTGGCTGTTGAAGAAAGCGTACCTAGTGGAATA
NM_001135691.2      ATCTTCTCCTTCTTCAACAACAACACCGTGGCTGTTGAAGAAAGCGTACCTAGTGGAATA
NM_001142324.1      ATCTTCTCCTTCTTCAACAACAACACCGTGGCTGTTGAAGAAAGCGTACCTAGTGGAATA
NM_003053.3         ATCTTCTCCTTCTTCAACAACAACACCGTGGCTGTTGAAGAAAGCGTACCTAGTGGAATA
                    ************************************************************

HsCD00045462        GCATGGATGAATGACACTGCCAGCACCATCCCACCTCCAGCCACTGAAGCCATCTCAGCT
NM_001135691.2      GCATGGATGAATGACACTGCCAGCACCATCCCACCTCCAGCCACTGAAGCCATCTCAGCT
NM_001142324.1      GCATGGATGAATGACACTGCCAGCACCATCCCACCTCCAGCCACTGAAGCCATCTCAGCT
NM_003053.3         GCATGGATGAATGACACTGCCAGCACCATCCCACCTCCAGCCACTGAAGCCATCTCAGCT
                    ************************************************************

HsCD00045462        CATAAAAACAACTGCTTGCAAGGCACAGGTTTCTTGGAGGAAGAGACTACCCGGGTCGGG
NM_001135691.2      CATAAAAACAACTGCTTGCAAGGCACAGGTTTCTTGGAGGAAGAGATTACCCGGGTCGGG
NM_001142324.1      CATAAAAACAACTGCTTGCAAGGCACAGGTTTCTTGGAGGAAGAGATTACCCGGGTCGGG
NM_003053.3         CATAAAAACAACTGCTTGCAAGGCACAGGTTTCTTGGAGGAAGAGATTACCCGGGTCGGG
                    ********************************************** *************

HsCD00045462        GTTCTGTTTGCTTCAAAGGCTGTGATGCAACTTCTGGTCAACCCATTCGTGGGCCCTCTC
NM_001135691.2      GTTCTGTTTGCTTCAAAGGCTGTGATGCAACTTCTGGTCAACCCATTCGTGGGCCCTCTC
NM_001142324.1      GTTCTGTTTGCTTCAAAGGCTGTGATGCAACTTCTGGTCAACCCATTCGTGGGCCCTCTC
NM_003053.3         GTTCTGTTTGCTTCAAAGGCTGTGATGCAACTTCTGGTCAACCCATTCGTGGGCCCTCTC
                    ************************************************************

HsCD00045462        ACCAACAGGATTGGATATCATATCCCCATGTTTGCTGGCTTTGTTATCATGTTTCTCTCC
NM_001135691.2      ACCAACAGGATTGGATATCATATCCCCATGTTTGCTGGCTTTGTTATCATGTTTCTCTCC
NM_001142324.1      ACCAACAGGATTGGATATCATATCCCCATGTTTGCTGGCTTTGTTATCATGTTTCTCTCC
NM_003053.3         ACCAACAGGATTGGATATCATATCCCCATGTTTGCTGGCTTTGTTATCATGTTTCTCTCC
                    ************************************************************

HsCD00045462        ACAGTTATGTTTGCTTTTTCTGGGACCTATACTCTACTCTTTGTGGCCCGAACCCTTCAA
NM_001135691.2      ACAGTTATGTTTGCTTTTTCTGGGACCTATACTCTACTCTTTGTGGCCCGAACCCTTCAA
NM_001142324.1      ACAGTTATGTTTGCTTTTTCTGGGACCTATACTCTACTCTTTGTGGCCCGAACCCTTCAA
NM_003053.3         ACAGTTATGTTTGCTTTTTCTGGGACCTATACTCTACTCTTTGTGGCCCGAACCCTTCAA
                    ************************************************************

HsCD00045462        GGCATTGGATCTTCATTTTCATCTGTTGCAGGTCTTGGAATGCTGGCCAGTGTCTACACT
NM_001135691.2      GGCATTGGATCTTCATTTTCATCTGTTGCAGGTCTTGGAATGCTGGCCAGTGTCTACACT
NM_001142324.1      GGCATTGGATCTTCATTTTCATCTGTTGCAGGTCTTGGAATGCTGGCCAGTGTCTACACT
NM_003053.3         GGCATTGGATCTTCATTTTCATCTGTTGCAGGTCTTGGAATGCTGGCCAGTGTCTACACT
                    ************************************************************

HsCD00045462        GATGACCATGAGAGAGGACGAGCCATGGGAACTGCTCTGGGGGGCCTGGCCTTGGGGTTG
NM_001135691.2      GATGACCATGAGAGAGGACGAGCCATGGGAACTGCTCTGGGGGGCCTGGCCTTGGGGTTG
NM_001142324.1      GATGACCATGAGAGAGGACGAGCCATGGGAACTGCTCTGGGGGGCCTGGCCTTGGGGTTG
NM_003053.3         GATGACCATGAGAGAGGACGAGCCATGGGAACTGCTCTGGGGGGCCTGGCCTTGGGGTTG
                    ************************************************************

HsCD00045462        CTGGTGGGAGCTCCCTTTGGAAGTGTAATGTACGAGTTTGTTGGGAAGTCTGCACCCTTC
NM_001135691.2      CTGGTGGGAGCTCCCTTTGGAAGTGTAATGTACGAGTTTGTTGGGAAGTCTGCACCCTTC
NM_001142324.1      CTGGTGGGAGCTCCCTTTGGAAGTGTAATGTACGAGTTTGTTGGGAAGTCTGCACCCTTC
NM_003053.3         CTGGTGGGAGCTCCCTTTGGAAGTGTAATGTACGAGTTTGTTGGGAAGTCTGCACCCTTC
                    ************************************************************

HsCD00045462        CTCATCCTGGCCTTCCTGGCACTACTGGATGGAGCACTCCAGCTTTGCATCCTACAGCCT
NM_001135691.2      CTCATCCTGGCCTTCCTGGCACTACTGGATGGAGCACTCCAGCTTTGCATCCTACAGCCT
NM_001142324.1      CTCATCCTGGCCTTCCTGGCACTACTGGATGGAGCACTCCAGCTTTGCATCCTACAGCCT
NM_003053.3         CTCATCCTGGCCTTCCTGGCACTACTGGATGGAGCACTCCAGCTTTGCATCCTACAGCCT
                    ************************************************************

HsCD00045462        TCCAAAGTCTCTCCTGAGAGTGCCAAGGGGACTCCCCTCTTTATGCTTCTCAAAGACCCT
NM_001135691.2      TCCAAAGTCTCTCCTGAGAGTGCCAAGGGGACTCCCCTCTTTATGCTTCTCAAAGACCCT
NM_001142324.1      TCCAAAGTCTCTCCTGAGAGTGCCAAGGGGACTCCCCTCTTTATGCTTCTCAAAGACCCT
NM_003053.3         TCCAAAGTCTCTCCTGAGAGTGCCAAGGGGACTCCCCTCTTTATGCTTCTCAAAGACCCT
                    ************************************************************

HsCD00045462        TACATCCTGGTGGCTGCAGG----------------------------------------
NM_001135691.2      TACATCCTGGTGGCTGCAGGGTCCATCTGCTTTGCCAACATGGGGGTGGCCATCCTGGAG
NM_001142324.1      TACATCCTGGTGGCTGCAGG----------------------------------------
NM_003053.3         TACATCCTGGTGGCTGCAGGGTCCATCTGCTTTGCCAACATGGGGGTGGCCATCCTGGAG
                    ********************                                        

HsCD00045462        --------------------------------------------------------TCTA
NM_001135691.2      CCCACACTGCCCATCTGGATGATGCAGACCATGTGCTCCCCCAAGTGGCAGCTGGGTCTA
NM_001142324.1      --------------------------------------------------------TCTA
NM_003053.3         CCCACACTGCCCATCTGGATGATGCAGACCATGTGCTCCCCCAAGTGGCAGCTGGGTCTA
                                                                            ****

HsCD00045462        GCTTTCTTGCCTGCCAGTGTGTCCTACCTCATTGGCACCAACCTCTTTGGTGTGTTGGCC
NM_001135691.2      GCTTTCTTGCCTGCCAGTGTGTCCTACCTCATTGGCACCAACCTCTTTGGTGTGTTGGCC
NM_001142324.1      GCTTTCTTGCCTGCCAGTGTGTCCTACCTCATTGGCACCAACCTCTTTGGTGTGTTGGCC
NM_003053.3         GCTTTCTTGCCTGCCAGTGTGTCCTACCTCATTGGCACCAACCTCTTTGGTGTGTTGGCC
                    ************************************************************

HsCD00045462        AACAAGATGGGTCGGTGGCTGTGTTCCCTAATCGGGATGCTGGTAGTAGGTACCAGCTTG
NM_001135691.2      AACAAGATGGGTCGGTGGCTGTGTTCCCTAATCGGGATGCTGGTAGTAGGTACCAGCTTG
NM_001142324.1      AACAAGATGGGTCGGTGGCTGTGTTCCCTAATCGGGATGCTGGTAGTAGGTACCAGCTTG
NM_003053.3         AACAAGATGGGTCGGTGGCTGTGTTCCCTAATCGGGATGCTGGTAGTAGGTACCAGCTTG
                    ************************************************************

HsCD00045462        CTCTGTGTTCCTCTGGCTCACAATATTTTTGGTCTCATTGGCCCCAATGCAGGGCTTGGC
NM_001135691.2      CTCTGTGTTCCTCTGGCTCACAATATTTTTGGTCTCATTGGCCCCAATGCAGGGCTTGGC
NM_001142324.1      CTCTGTGTTCCTCTGGCTCACAATATTTTTGGTCTCATTGGCCCCAATGCAGGGCTTGGC
NM_003053.3         CTCTGTGTTCCTCTGGCTCACAATATTTTTGGTCTCATTGGCCCCAATGCAGGGCTTGGC
                    ************************************************************

HsCD00045462        CTTGCCATAGGCATGGTGGATTCTTCTATGATGCCCATCATGGGGCACCTGGTGGATCTA
NM_001135691.2      CTTGCCATAGGCATGGTGGATTCTTCTATGATGCCCATCATGGGGCACCTGGTGGATCTA
NM_001142324.1      CTTGCCATAGGCATGGTGGATTCTTCTATGATGCCCATCATGGGGCACCTGGTGGATCTA
NM_003053.3         CTTGCCATAGGCATGGTGGATTCTTCTATGATGCCCATCATGGGGCACCTGGTGGATCTA
                    ************************************************************

HsCD00045462        CGCCACACCTCGGTGTATGGGAGTGTCTACGCCATCGCTGATGTGGCTTTTTGCATGGGC
NM_001135691.2      CGCCACACCTCGGTGTATGGGAGTGTCTACGCCATCGCTGATGTGGCTTTTTGCATGGGC
NM_001142324.1      CGCCACACCTCGGTGTATGGGAGTGTCTACGCCATCGCTGATGTGGCTTTTTGCATGGGC
NM_003053.3         CGCCACACCTCGGTGTATGGGAGTGTCTACGCCATCGCTGATGTGGCTTTTTGCATGGGC
                    ************************************************************

HsCD00045462        TTTGCTATAGGTCCATCCACCGGTGGTGCCATTGTAAAGGCCATCGGTTTTCCCTGGCTC
NM_001135691.2      TTTGCTATAGGTCCATCCACCGGTGGTGCCATTGTAAAGGCCATCGGTTTTCCCTGGCTC
NM_001142324.1      TTTGCTATAGGTCCATCCACCGGTGGTGCCATTGTAAAGGCCATCGGTTTTCCCTGGCTC
NM_003053.3         TTTGCTATAGGTCCATCCACCGGTGGTGCCATTGTAAAGGCCATCGGTTTTCCCTGGCTC
                    ************************************************************

HsCD00045462        ATGGTCATCACTGGGGTCATCAACATCGTCTATGCTCCACTCTGCTACTACCTGCGGAGC
NM_001135691.2      ATGGTCATCACTGGGGTCATCAACATCGTCTATGCTCCACTCTGCTACTACCTGCGGAGC
NM_001142324.1      ATGGTCATCACTGGGGTCATCAACATCGTCTATGCTCCACTCTGCTACTACCTGCGGAGC
NM_003053.3         ATGGTCATCACTGGGGTCATCAACATCGTCTATGCTCCACTCTGCTACTACCTGCGGAGC
                    ************************************************************

HsCD00045462        CCCCCGGCAAAGGAAGAGAAGCTTGCTATTCTGAGTCAGGACTGCCCCATGGAGACCCGG
NM_001135691.2      CCCCCGGCAAAGGAAGAGAAGCTTGCTATTCTGAGTCAGGACTGCCCCATGGAGACCCGG
NM_001142324.1      CCCCCGGCAAAGGAAGAGAAGCTTGCTATTCTGAGTCAGGACTGCCCCATGGAGACCCGG
NM_003053.3         CCCCCGGCAAAGGAAGAGAAGCTTGCTATTCTGAGTCAGGACTGCCCCATGGAGACCCGG
                    ************************************************************

HsCD00045462        ATGTATGCAACCCAGAAGCCCACGAAGGAATTTCCTCTGGGGGAGGACAGTGATGAGGAG
NM_001135691.2      ATGTATGCAACCCAGAAGCCCACGAAGGAATTTCCTCTGGGGGAGGACAGTGATGAGGAG
NM_001142324.1      ATGTATGCAACCCAGAAGCCCACGAAGGAATTTCCTCTGGGGGAGGACAGTGATGAGGAG
NM_003053.3         ATGTATGCAACCCAGAAGCCCACGAAGGAATTTCCTCTGGGGGAGGACAGTGATGAGGAG
                    ************************************************************

HsCD00045462        CCTGACCATGAGGAGTAG
NM_001135691.2      CCTGACCATGAGGAGTAG
NM_001142324.1      CCTGACCATGAGGAGTAG
NM_003053.3         CCTGACCATGAGGAGTAG
                    ******************

Pathways

Panther : 5HT1 type receptor mediated signaling pathway
Panther : 5HT2 type receptor mediated signaling pathway
Panther : 5HT3 type receptor mediated signaling pathway
Panther : 5HT4 type receptor mediated signaling pathway
Panther : Adrenaline and noradrenaline biosynthesis
Reactome : Amine compound SLC transporters
Reactome : Na+/Cl- dependent neurotransmitter transporters
Reactome : SLC-mediated transmembrane transport
Reactome : Transmembrane transport of small molecules
Reactome : Transport of glucose and other sugars, bile salts and organic acids, metal ions and amine compounds

Protein

UniProt : Q96GL6
UniProt : E9PB33
UniProt : Q9BRE4
UniProt : E9PDJ5
UniProt : P54219
HPRD : 01897

Clone

Cloning Information : 263529
HIP Master Clone ID : 196317
Original Clone ID : FLH263529.01X

Organism


TAX_ID : 9606
Species Specific ID: 6570

Genome

Chromosome : 8
Map Location : 8p21.3
Ensembl : ENSG00000036565

Reagents

Labome : SLC18A1-antibody