DNASU Plasmid Repository • 480.965.5697 | Email

IRF3 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IRF3
Gene Name:  interferon regulatory factor 3
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH193134.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00045472

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1359nts         Open reading frame : 1 to 1359
Reference Sequence Alignment

ATGGGAACCCCAAAGCCACGGATCCTGCCCTGGCTGGTGTCGCAGCTGGACCTGGGGCAA
CTGGAGGGCGTGGCCTGGGTGAACAAGAGCCGCACGCGCTTCCGCATCCCTTGGAAGCAC
GGCCTACGGCAGGATGCACAGCAGGAGGATTTCGGAATCTTCCAGGCCTGGGCCGAGGCC
ACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACCTGGAAGAGGAATTTC
CGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGACCGGAGCAAGGACCCT
CACGACCCACATAAAATCTACGAGTTTGTGAACTCAGGAGTTGGGGACTTTTCCCAGCCA
GACACCTCTCCGGACACCAATGGTGGAGGCAGTACTTCTGATACCCAGGAAGACATTCTG
GATGAGTTACTGGGTAACATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTG
GCTGTAGCCCCTGAGCCCTGCCCTCAGCCCCTGCGGAGCCCCAGCTTGGACAATCCCACT
CCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAAGCGGCTGTTGGTGCCGGGGGAA
GAGTGGGAGTTCGAGGTGACAGCCTTCTACCGGGGCCGCCAAGTCTTCCAGCAGACCATC
TCCTGCCCGGAGGGCCTGCGGCTGGTGGGGTCCGAAGTGGGAGACAGGACGCTGCCTGGA
TGGCCAGTCACACTGCCAGACCCTGGCATGTCCCTGACAGACAGGGGAGTGATGAGCTAC
GTGAGGCATGTGCTGAGCTGCCTGGGTGGGGGACTGGCTCTCTGGCGGGCCGGGCAGTGG
CTCTGGGCCCAGCGGCTGGGGCACTGCCACACATACTGGGCAGTGAGCGAGGAGCTGCTC
CCCAACAGCGGGCATGGGCCTGATGGCGAGGTCCCCAAGGACAAGGAAGGAGGCGTGTTT
GACCTGGGGCCCTTCATTGTAGGCTCCTGGGCCCCCAGATCTGATTACCTTCACGGAAGG
AAGCGGACGCTCACCACGCTATGCCCTCTGGTTCTGTGTGGGGGAGTCATGGCCCCAGGA
CCAGCCGTGGACCAAGAGGCTCGTGATGGTCAAGGTTGTGCCCACGTGCCTCAGGGCCTT
GGTAGAAATGGCCCGGGTAGGGGGTGCCTCCTCCCTGGAGAATACTGTGGACCTGCACAT
TTCCAACAGCCACCCACTCTCCCTCACCTCCGACCAGTACAAGGCCTACCTGCAGGACTT
GGTGGAGGGCATGGATTTCCAGGGCCCTGGGGAGACCTGAGCCCTCGCTCCTCATGGTGT
GCCTCCAACCCCCCTGTTCCCCACCACCTCAACCAATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1548
Start on reference sequence 190
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IRF3
Symbol Nomenclature : IRF3
Full Nomenclature : interferon regulatory factor 3
GENEID : 3661
HGNC : 6118
MIM : 603734
Vega : OTTHUMG00000183287
Target GenBank: BC009395

 

Reference Sequence Alignment

  

HsCD00045472        ATGGGAACCCCAAAGCCACGGATCCTGCCCTGGCTGGTGTCGCAGCTGGACCTGGGGCAA
NM_001197122.1      ATGGGAACCCCAAAGCCACGGATCCTGCCCTGGCTGGTGTCGCAGCTGGACCTGGGGCAA
                    ************************************************************

HsCD00045472        CTGGAGGGCGTGGCCTGGGTGAACAAGAGCCGCACGCGCTTCCGCATCCCTTGGAAGCAC
NM_001197122.1      CTGGAGGGCGTGGCCTGGGTGAACAAGAGCCGCACGCGCTTCCGCATCCCTTGGAAGCAC
                    ************************************************************

HsCD00045472        GGCCTACGGCAGGATGCACAGCAGGAGGATTTCGGAATCTTCCAGGCCTGGGCCGAGGCC
NM_001197122.1      GGCCTACGGCAGGATGCACAGCAGGAGGATTTCGGAATCTTCCAGGCCTGGGCCGAGGCC
                    ************************************************************

HsCD00045472        ACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACCTGGAAGAGGAATTTC
NM_001197122.1      ACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACCTGGAAGAGGAATTTC
                    ************************************************************

HsCD00045472        CGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGACCGGAGCAAGGACCCT
NM_001197122.1      CGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGACCGGAGCAAGGACCCT
                    ************************************************************

HsCD00045472        CACGACCCACATAAAATCTACGAGTTTGTGAACTCAGGAGTTGGGGACTTTTCCCAGCCA
NM_001197122.1      CACGACCCACATAAAATCTACGAGTTTGTGAACTCAGGAGTTGGGGACTTTTCCCAGCCA
                    ************************************************************

HsCD00045472        GACACCTCTCCGGACACCAATGGTGGAGGCAGTACTTCTGATACCCAGGAAGACATTCTG
NM_001197122.1      GACACCTCTCCGGACACCAATGGTGGAGGCAGTACTTCTGATACCCAGGAAGACATTCTG
                    ************************************************************

HsCD00045472        GATGAGTTACTGGGTAACATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTG
NM_001197122.1      GATGAGTTACTGGGTAACATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTG
                    ************************************************************

HsCD00045472        GCTGTAGCCCCTGAGCCCTGCCCTCAGCCCCTGCGGAGCCCCAGCTTGGACAATCCCACT
NM_001197122.1      GCTGTAGCCCCTGAGCCCTGCCCTCAGCCCCTGCGGAGCCCCAGCTTGGACAATCCCACT
                    ************************************************************

HsCD00045472        CCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAAGCGGCTGTTGGTGCCGGGGGAA
NM_001197122.1      CCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAAGCGGCTGTTGGTGCCGGGGGAA
                    ************************************************************

HsCD00045472        GAGTGGGAGTTCGAGGTGACAGCCTTCTACCGGGGCCGCCAAGTCTTCCAGCAGACCATC
NM_001197122.1      GAGTGGGAGTTCGAGGTGACAGCCTTCTACCGGGGCCGCCAAGTCTTCCAGCAGACCATC
                    ************************************************************

HsCD00045472        TCCTGCCCGGAGGGCCTGCGGCTGGTGGGGTCCGAAGTGGGAGACAGGACGCTGCCTGGA
NM_001197122.1      TCCTGCCCGGAGGGCCTGCGGCTGGTGGGGTCCGAAGTGGGAGACAGGACGCTGCCTGGA
                    ************************************************************

HsCD00045472        TGGCCAGTCACACTGCCAGACCCTGGCATGTCCCTGACAGACAGGGGAGTGATGAGCTAC
NM_001197122.1      TGGCCAGTCACACTGCCAGACCCTGGCATGTCCCTGACAGACAGGGGAGTGATGAGCTAC
                    ************************************************************

HsCD00045472        GTGAGGCATGTGCTGAGCTGCCTGGGTGGGGGACTGGCTCTCTGGCGGGCCGGGCAGTGG
NM_001197122.1      GTGAGGCATGTGCTGAGCTGCCTGGGTGGGGGACTGGCTCTCTGGCGGGCCGGGCAGTGG
                    ************************************************************

HsCD00045472        CTCTGGGCCCAGCGGCTGGGGCACTGCCACACATACTGGGCAGTGAGCGAGGAGCTGCTC
NM_001197122.1      CTCTGGGCCCAGCGGCTGGGGCACTGCCACACATACTGGGCAGTGAGCGAGGAGCTGCTC
                    ************************************************************

HsCD00045472        CCCAACAGCGGGCATGGGCCTGATGGCGAGGTCCCCAAGGACAAGGAAGGAGGCGTGTTT
NM_001197122.1      CCCAACAGCGGGCATGGGCCTGATGGCGAGGTCCCCAAGGACAAGGAAGGAGGCGTGTTT
                    ************************************************************

HsCD00045472        GACCTGGGGCCCTTCATTGTAGGCTCCTGGGCCCCCAGATCTGATTACCTTCACGGAAGG
NM_001197122.1      GACCTGGGGCCCTTCATTGTAGGCTCCTGGGCCCCCAGATCTGATTACCTTCACGGAAGG
                    ************************************************************

HsCD00045472        AAGCGGACGCTCACCACGCTATGCCCTCTGGTTCTGTGTGGGGGAGTCATGGCCCCAGGA
NM_001197122.1      AAGCGGACGCTCACCACGCTATGCCCTCTGGTTCTGTGTGGGGGAGTCATGGCCCCAGGA
                    ************************************************************

HsCD00045472        CCAGCCGTGGACCAAGAGGCTCGTGATGGTCAAGGTTGTGCCCACGTGCCTCAGGGCCTT
NM_001197122.1      CCAGCCGTGGACCAAGAGGCTCGTGATGGTCAAGGTTGTGCCCACGTGCCTCAGGGCCTT
                    ************************************************************

HsCD00045472        GGTAGAAATGGCCCGGGTAGGGGGTGCCTCCTCCCTGGAGAATACTGTGGACCTGCACAT
NM_001197122.1      GGTAGAAATGGCCCGGGTAGGGGGTGCCTCCTCCCTGGAGAATACTGTGGACCTGCACAT
                    ************************************************************

HsCD00045472        TTCCAACAGCCACCCACTCTCCCTCACCTCCGACCAGTACAAGGCCTACCTGCAGGACTT
NM_001197122.1      TTCCAACAGCCACCCACTCTCCCTCACCTCCGACCAGTACAAGGCCTACCTGCAGGACTT
                    ************************************************************

HsCD00045472        GGTGGAGGGCATGGATTTCCAGGGCCCTGGGGAGACCTGAGCCCTCGCTCCTCATGGTGT
NM_001197122.1      GGTGGAGGGCATGGATTTCCAGGGCCCTGGGGAGAGCTGAGCCCTCGCTCCTCATGGTGT
                    *********************************** ************************

HsCD00045472        GCCTCCAACCCCCCTGTTCCCCACCACCTCAACCAATAG
NM_001197122.1      GCCTCCAACCCCCCTGTTCCCCACCACCTCAACCAATAA
                    **************************************.

Pathways

Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Activation of IRF3/IRF7 mediated by TBK1/IKK epsilon
Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Cytokine Signaling in Immune system
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : Hemostasis
Reactome : IRF3 mediated activation of type 1 IFN
Reactome : IRF3-mediated induction of type I IFN
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : Interferon gamma signaling
Reactome : LRR FLII-interacting protein 1 (LRRFIP1) activates type I IFN production
Reactome : MyD88-independent cascade
Reactome : Negative regulators of RIG-I/MDA5 signaling
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulation of innate immune responses to cytosolic DNA
Reactome : STING mediated induction of host immune responses
Reactome : TRAF3-dependent IRF activation pathway
Reactome : TRAF6 mediated IRF7 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : ZBP1(DAI) mediated induction of type I IFNs
WikiPathway : Apoptosis
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

SMART domain : IRF : interferon regulatory factor
UniProt : E2GIM6
UniProt : E2GIM7
UniProt : Q14653
UniProt : E2GIM8
UniProt : E2GIM9
UniProt : Q7Z5G6
UniProt : Q5FBY2
UniProt : Q5FBY1
UniProt : E2GIM5
HPRD : 04769

Clone

Cloning Information : 193134
HIP Master Clone ID : 167845
Original Clone ID : FLH193134.01X

Organism


TAX_ID : 9606
Species Specific ID: 3661

Genome

Chromosome : 19
Map Location : 19q13.3-q13.4
Ensembl : ENSG00000126456

Reagents

Labome : IRF-3-antibody