DNASU Plasmid Repository • 480.965.5697 | Email

Taci_0171 (T. acidaminovorans DSM 6589 ) in pMCSG7 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  Taci_0171
Gene Name:  PAS/PAC sensor protein
Sequence             
Original Clone ID: APC100774.102
Keyword: None
Species: Thermanaerovibrio acidaminovorans DSM 6589
Type: cDNA
Vector Name: pMCSG7               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Midwest Center for Structural Genomics
Shonda Clancy
PSI:Biology
TaCD00454734

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1158nts         Open reading frame : 43 to 1200

GTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCAATGCCTTGAGCGATAAAATCGAT
CCTATAAGGGACCTGTTGAATTACCATCCGGATATGTTGTTTGTGCTGGATCGATCGGGC
AGGATAGTTGAGGCCGGCGCGTCGGCTTTCGTGTTTTTGGGTCTAATGCCCAACGATATA
AGGGGAACCAGCTTCGCCAACTTGTTGCCGCCGGACAGGAGGGAGGAGTTCCTTCGCTTT
ATATCGCGACCCAGGATGCTTAGAATGAACCGTTACCCGATGGTGAGGCACGATGGTGTG
GAGGTCACCATGGAGCTCCACGTGTCCAAGGGCTCCTGGGCGGGAGAGGAGGCCATATAC
CTCACCGCCATAGACTTGTCGGAACGTGTCCGCTCCGAGGCTCAGGTGGAGTTCTACATG
GAGGAGATGGAGCGGATCGCCATGAAGTTGCGGCAGACCCAGCAGGCCCTGGACGACCAG
CTCCAGAAGGCGGCCAAGCTCCATCGGAAGCTGATGCCCGCCATCCCTAAGATGGAGGGC
ATCGTGGGAGCCGGCTGTTTCGATCCCGCCTCTCGCATAGGGGGGGACTTTTACGGGGTG
GTTCCCCTGGGGGACCGGGCGCTGGCGTACCTGGTGGACGTGAGCGGACACGGGCTGGAT
GGGGCCCTCATCTCCCTTTTCGTTAGGGACTGGGTGGCGGAGTACCTTTCGGGCAGAACT
CCCTCCCAGGTGGACCCCCTGAACCTGCTTGAACACATATCGAGCCGTTTCCTTGGGGAG
GAACTCCTGTACGATTACTTCATCTGCCTCCAGATAGCCCTGTTTGACCGAGGCAAGGGC
ACGTTTCGCCTGGTCAACGCTGGCAACCCGGTGAGGCCCATGCTGTTCACCCCTGAAGGG
GGAGTCGCGCTGTTGGACTGCGTTGGGACTCCGGTGGCAGGTTTGGGCGAAGAGGATATA
ACCCCGGTGGAGGTGCCGTTCCGGAGTGGCTCGAGGCTGCTCCTCCTTACCGACGGAGTT
GTGGATCAGGACTCCTCTGGTGAGAGGTTTGGAGTCTTTAGGGTCAAGGACCTGCTGGAG
CGCCACGGTGCGGAGTCGCCTGAGGAGATCCTCCGGGCGATATACTCCGCCTTCCAGACG
TTCCTTGGCGATAAGCCCCGAAGGGACGACGTGACTATGCTGTGCTTCGGAGCGGAATAA
CATTGGAAGTGGATAATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in MCSG-APC100774
Recommended expression in: E.coli BL21 (DE3)
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG7

pMCSG7 in advanced viewed

Synonyms: pMCSG-7
Sequencing Primer: Forward:  T7short
Reverse:  T7 terminator
Description: Bacterial expresson vector with T7 promoter, adds N-terminal His tag and TEV protease site; amp resistance; ligation independent cloning (LIC).
Comments: pET21 derivative; for routine HTP purification
Size (bp): 5286
Parent Vector: None
Empty Vector: EvNO00084271
Properties: bacterial expression, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 12071693
Title: A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC ligation-independent cloning (LIC) region 204 235
bacterial origin ori ColE1 pBR322-type bacterial origin of replication 3280 3280
promoter T7 T7 promoter 360 376
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 335 357
repressor protein gene LacI LacI coding region 890 1849
selectable marker AmpR ampicillin resistance gene 4038 4898
tag His 2 N-terminal 6xHis tag 268 285
tag His C-terminal 6xHis tag 140 157
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : Taci_0171
GENEID : 8629981
Locus Tag : Taci_0171
GI : 269099424
Target GenBank: None

 

Protein

SMART domain : PP2C_SIG : Sigma factor PP2C-like phosphatases
SMART domain : PAS : PAS domain
Structural Annotation Wiki : TOPSAN
Structural Annotation Wiki : MCSG-APC100774

Clone

Cloning Information : 584843
HIP Master Clone ID : 487772
Original Clone ID : APC100774.102

Experimental

TargetTrack - Experimental data : MCSG-APC100774

Organism


TAX_ID : 525903
Species Specific ID: 8629981

Reagents

Labome : Taci_0171-cDNA