DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pMCSG49


Explanation of Terms

Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pMCSG49              
Source: Midwest Center for Structural Genomics
Description: Bacterial expression vector with a T7 promoter and N-terminal 6xHis tag, TEV cleavable; ampicillin resistance in bacteria; Ligation Independent cloning
Comments: None
Publications: None
Authors: Midwest Center for Structural Genomics
Midwest Center for Structural Genomics

Price:  Login for Pricing
No restriction
Special MTA: PSI



 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG49

pMCSG49 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  T7 short
Reverse:  T7 terminator
Description: Bacterial expression vector with a T7 promoter and N-terminal 6xHis tag, TEV cleavable; ampicillin resistance in bacteria; Ligation Independent cloning
Comments: pMCSG7 digested with PshAI and BsaAI to remove a 1008 bp fragment containing the rop repressor gene and then re-ligated. Origin of replication now similar to the pUC vectors.
Size (bp): 4278
Parent Vector: None
Properties: bacterial expression, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Midwest Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 origin of replication 2271 2859
ligation independent cloning LIC LIC site 204 235
primer forward forward sequencing primer TAATACGACTCACTATAGGG 357 376
promoter T7 T7 promoter 360 376
protease cleavage site TEV TEV protease cleavage site 223 243
repressor binding site lac operator LacO fragment 335 357
repressor protein gene LacI LacI CDS 890 1849
selectable marker AmpR Ampicillin resistance gene 3030 3890
tag His N-terminal 6xHis tag 268 285
trxn termination sequence T7 term T7 transcription termination sequence 26 72


Species Specific ID: None
Target GenBank: None