DNASU Plasmid Repository • 480.965.5697 | Email

IRF1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IRF1
Gene Name:  interferon regulatory factor 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH009746.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00000455

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 978nts         Open reading frame : 1 to 978
Reference Sequence Alignment

ATGCCCATCACTCGGATGCGCATGAGACCCTGGCTAGAGATGCAGATTAATTCCAACCAA
ATCCCGGGGCTCATCTGGATTAATAAAGAGGAGATGATCTTCCAGATCCCATGGAAGCAT
GCTGCCAAGCATGGCTGGGACATCAACAAGGATGCCTGTTTGTTCCGGAGCTGGGCCATT
CACACAGGCCGATACAAAGCAGGGGAAAAGGAGCCAGATCCCAAGACGTGGAAGGCCAAC
TTTCGCTGTGCCATGAACTCCCTGCCAGATATCGAGGAGGTGAAAGACCAGAGCAGGAAC
AAGGGCAGCTCAGCTGTGCGAGTGTACCGGATGCTTCCACCTCTCACCAAGAACCAGAGA
AAAGAAAGAAAGTCGAAGTCCAGCCGAGATGCTAAGAGCAAGGCCAAGAGGAAGTCATGT
GGGGATTCCAGCCCTGATACCTTCTCTGATGGACTCAGCAGCTCCACTCTGCCTGATGAC
CACAGCAGCTACACAGTTCCAGGCTACATGCAGGACTTGGAGGTGGAGCAGGCCCTGACT
CCAGCACTGTCGCCGTGTGCTGTCAGCAGCACTCTCCCCGACTGGCACATCCCAGTGGAA
GTTGTGCCGGACAGCACCAGTGATCTGTACAACTTCCAGGTGTCACCCATGCCCTCCACC
TCTGAAGCTACAACAGATGAGGATGAGGAAGGGAAATTACCTGAGGACATCATGAAGCTC
TTGGAGCAGTCGGAGTGGCAGCCAACAAACGTGGATGGGAAGGGGTACCTACTCAATGAA
CCTGGAGTCCAGCCCACCTCTGTCTATGGAGACTTTAGCTGTAAGGAGGAGCCAGAAATT
GACAGCCCAGGGGGGGATATTGGGCTGAGTCTACAGCGTGTCTTCACAGATCTGAAGAAC
ATGGATGCCACCTGGCTGGACAGCCTGCTGACCCCAGTCCGGTTGCCCTCCATCCAGGCC
ATTCCCTGTGCACCGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1175
Start on reference sequence 198
Mutations:
None
Discrepancy:
a555g
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IRF1
Symbol Nomenclature : IRF1
SYNONYM : IRF-1; MAR
Designation : interferon regulatory factor 1 isoform d78
Full Nomenclature : interferon regulatory factor 1
GENEID : 3659
GI : 61355850
GenBank Accession : AY888238
HGNC : 6116
MIM : 147575
Vega : OTTHUMG00000059497
Target GenBank: NM_002198

 

Reference Sequence Alignment

  

HsCD00000455      ATGCCCATCACTCGGATGCGCATGAGACCCTGGCTAGAGATGCAGATTAATTCCAACCAA
NM_002198.2       ATGCCCATCACTCGGATGCGCATGAGACCCTGGCTAGAGATGCAGATTAATTCCAACCAA
                  ************************************************************

HsCD00000455      ATCCCGGGGCTCATCTGGATTAATAAAGAGGAGATGATCTTCCAGATCCCATGGAAGCAT
NM_002198.2       ATCCCGGGGCTCATCTGGATTAATAAAGAGGAGATGATCTTCCAGATCCCATGGAAGCAT
                  ************************************************************

HsCD00000455      GCTGCCAAGCATGGCTGGGACATCAACAAGGATGCCTGTTTGTTCCGGAGCTGGGCCATT
NM_002198.2       GCTGCCAAGCATGGCTGGGACATCAACAAGGATGCCTGTTTGTTCCGGAGCTGGGCCATT
                  ************************************************************

HsCD00000455      CACACAGGCCGATACAAAGCAGGGGAAAAGGAGCCAGATCCCAAGACGTGGAAGGCCAAC
NM_002198.2       CACACAGGCCGATACAAAGCAGGGGAAAAGGAGCCAGATCCCAAGACGTGGAAGGCCAAC
                  ************************************************************

HsCD00000455      TTTCGCTGTGCCATGAACTCCCTGCCAGATATCGAGGAGGTGAAAGACCAGAGCAGGAAC
NM_002198.2       TTTCGCTGTGCCATGAACTCCCTGCCAGATATCGAGGAGGTGAAAGACCAGAGCAGGAAC
                  ************************************************************

HsCD00000455      AAGGGCAGCTCAGCTGTGCGAGTGTACCGGATGCTTCCACCTCTCACCAAGAACCAGAGA
NM_002198.2       AAGGGCAGCTCAGCTGTGCGAGTGTACCGGATGCTTCCACCTCTCACCAAGAACCAGAGA
                  ************************************************************

HsCD00000455      AAAGAAAGAAAGTCGAAGTCCAGCCGAGATGCTAAGAGCAAGGCCAAGAGGAAGTCATGT
NM_002198.2       AAAGAAAGAAAGTCGAAGTCCAGCCGAGATGCTAAGAGCAAGGCCAAGAGGAAGTCATGT
                  ************************************************************

HsCD00000455      GGGGATTCCAGCCCTGATACCTTCTCTGATGGACTCAGCAGCTCCACTCTGCCTGATGAC
NM_002198.2       GGGGATTCCAGCCCTGATACCTTCTCTGATGGACTCAGCAGCTCCACTCTGCCTGATGAC
                  ************************************************************

HsCD00000455      CACAGCAGCTACACAGTTCCAGGCTACATGCAGGACTTGGAGGTGGAGCAGGCCCTGACT
NM_002198.2       CACAGCAGCTACACAGTTCCAGGCTACATGCAGGACTTGGAGGTGGAGCAGGCCCTGACT
                  ************************************************************

HsCD00000455      CCAGCACTGTCGCCGTGTGCTGTCAGCAGCACTCTCCCCGACTGGCACATCCCAGTGGAA
NM_002198.2       CCAGCACTGTCGCCATGTGCTGTCAGCAGCACTCTCCCCGACTGGCACATCCCAGTGGAA
                  **************.*********************************************

HsCD00000455      GTTGTGCCGGACAGCACCAGTGATCTGTACAACTTCCAGGTGTCACCCATGCCCTCCACC
NM_002198.2       GTTGTGCCGGACAGCACCAGTGATCTGTACAACTTCCAGGTGTCACCCATGCCCTCCACC
                  ************************************************************

HsCD00000455      TCTGAAGCTACAACAGATGAGGATGAGGAAGGGAAATTACCTGAGGACATCATGAAGCTC
NM_002198.2       TCTGAAGCTACAACAGATGAGGATGAGGAAGGGAAATTACCTGAGGACATCATGAAGCTC
                  ************************************************************

HsCD00000455      TTGGAGCAGTCGGAGTGGCAGCCAACAAACGTGGATGGGAAGGGGTACCTACTCAATGAA
NM_002198.2       TTGGAGCAGTCGGAGTGGCAGCCAACAAACGTGGATGGGAAGGGGTACCTACTCAATGAA
                  ************************************************************

HsCD00000455      CCTGGAGTCCAGCCCACCTCTGTCTATGGAGACTTTAGCTGTAAGGAGGAGCCAGAAATT
NM_002198.2       CCTGGAGTCCAGCCCACCTCTGTCTATGGAGACTTTAGCTGTAAGGAGGAGCCAGAAATT
                  ************************************************************

HsCD00000455      GACAGCCCAGGGGGGGATATTGGGCTGAGTCTACAGCGTGTCTTCACAGATCTGAAGAAC
NM_002198.2       GACAGCCCAGGGGGGGATATTGGGCTGAGTCTACAGCGTGTCTTCACAGATCTGAAGAAC
                  ************************************************************

HsCD00000455      ATGGATGCCACCTGGCTGGACAGCCTGCTGACCCCAGTCCGGTTGCCCTCCATCCAGGCC
NM_002198.2       ATGGATGCCACCTGGCTGGACAGCCTGCTGACCCCAGTCCGGTTGCCCTCCATCCAGGCC
                  ************************************************************

HsCD00000455      ATTCCCTGTGCACCGTAG
NM_002198.2       ATTCCCTGTGCACCGTAG
                  ******************

Pathways

NCI : Glucocorticoid receptor regulatory network
NCI : IFN-gamma pathway
NCI : IL12 signaling mediated by STAT4
NCI : IL6-mediated signaling events
NCI : Regulation of Telomerase
Reactome : Cytokine Signaling in Immune system
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : Interferon gamma signaling
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : TRAF6 mediated IRF7 activation
WikiPathway : Apoptosis
WikiPathway : IL-6 signaling pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Senescence and Autophagy
WikiPathway : Type II interferon signaling (IFNG)

Protein

SMART domain : IRF : interferon regulatory factor
UniProt : Q6FHN8
UniProt : P10914
HPRD : 00961

Clone

Cloning Information : 9746
HIP Master Clone ID : 13655
Original Clone ID : FLH009746.01X

Organism


TAX_ID : 9606
Species Specific ID: 3659

Genome

Chromosome : 5
Map Location : 5q31.1
Ensembl : ENSG00000125347

Reagents

Labome : IRF-1-antibody