DNASU Plasmid Repository • 480.965.5697 | Email

TRAF2 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TRAF2
Gene Name:  TNF receptor-associated factor 2
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH182876.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00045633

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1506nts         Open reading frame : 1 to 1506
Reference Sequence Alignment

ATGGCTGCAGCTAGCGTGACCCCCCCTGGCTCCCTGGAGTTGCTACAGCCCGGCTTCTCC
AAGACCCTCCTGGGGACCAAGCTGGAAGCCAAGTACCTGTGCTCCGCCTGCAGAAACGTC
CTCCGCAGGCCCTTCCAGGCGCAGTGTGGCCACCGGTACTGCTCCTTCTGCCTGGCCAGC
ATCCTCAGCTCTGGGCCTCAGAACTGTGCTGCCTGTGTTCACGAGGGCATATATGAAGAA
GGCATTTCTATTTTAGAAAGCAGTTCGGCCTTCCCAGATAATGCTGCCCGCAGGGAGGTG
GAGAGCCTGCCGGCCGTCTGTCCCAGTGATGGATGCACCTGGAAGGGGACCCTGAAAGAA
TACGAGAGCTGCCACGAAGGCCGCTGCCCGCTCATGCTGACCGAATGTCCCGCGTGCAAA
GGCCTGGTCCGCCTTGGTGAAAAGGAGCGCCACCTGGAGCACGAGTGCCCGGAGAGAAGC
CTGAGCTGCCGGCATTGCCGGGCACCCTGCTGCGGAGCAGACGTGAAGGCGCACCACGAG
GTCTGCCCCAAGTTCCCCTTAACTTGTGACGGCTGCGGCAAGAAGAAGATCCCCCGGGAG
AAGTTTCAGGACCACGTCAAGACTTGTGGCAAGTGTCGAGTCCCTTGCAGATTCCACGCC
ATCGGCTGCCTCGAGACGGTAGAGGGTGAGAAACAGCAGGAGCACGAGGTGCAGTGGCTG
CGGGAGCACCTGGCCATGCTACTGAGCTCGGTGCTGGAGGCAAAGCCCCTCTTGGGAGAC
CAGAGCCACGCGGGGTCAGAGCTCCTGCAGAGGTGCGAGAGCCTGGAGAAGAAGACGGCC
ACTTTTGAGAACATTGTCTGCGTCCTGAACCGGGAGGTGGAGAGGGTGGCCATGACTGCC
GAGGCCTGCAGCCGGCAGCACCGGCTGGACCAAGACAAGATTGAAGCCCTGAGTAGCAAG
GTGCAGCAGCTGGAGAGGAGCATTGGCCTCAAGGACCTGGCGATGGCTGACTTGGAGCAG
AAGGTCTTGGAGATGGAGGCATCCACCTACGATGGGGTCTTCATCTGGAAGATCTCAGAC
TTCGCCAGGAAGCGCCAGGAAGCTGTGGCTGGCCGCATACCCGCCATCTTCTCCCCAGCC
TTCTACACCAGCAGGTACGGCTACAAGATGTGTCTGCGTATCTACCTGAACGGCGACGGC
ACCGGGCGAGGAACACACCTGTCCCTCTTCTTTGTGGTGATGAAGGGCCCGAATGACGCC
CTGCTGCGGTGGCCCTTCAACCAGAAGGTGACCTTAATGCTGCTCGACCAGAATAACCGG
GAGCACGTGATTGACGCCTTCAGGCCCGACGTGACTTCATCCTCTTTTCAGAGGCCAGTC
AACGACATGAACATCGCAAGCGGCTGCCCCCTCTTCTGCCCCGTCTCCAAGATGGAGGCA
AAGAATTCCTACGTGCGGGACGATGCCATCTTCATCAAGGCCATTGTGGACCTGACAGGG
CTCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1549
Start on reference sequence 44
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TRAF2
Symbol Nomenclature : TRAF2
SYNONYM : MGC:45012; TRAP; TRAP3
Designation : E3 ubiquitin-protein ligase TRAF2|tumor necrosis factor type 2 receptor associated protein 3|tumor necrosis factor type 2 receptor-associated protein 3
Full Nomenclature : TNF receptor-associated factor 2
GENEID : 7186
HGNC : 12032
MIM : 601895
Vega : OTTHUMG00000020952
Target GenBank: BC032410

 

Reference Sequence Alignment

  

HsCD00045633      ATGGCTGCAGCTAGCGTGACCCCCCCTGGCTCCCTGGAGTTGCTACAGCCCGGCTTCTCC
NM_021138.3       ATGGCTGCAGCTAGCGTGACCCCCCCTGGCTCCCTGGAGTTGCTACAGCCCGGCTTCTCC
                  ************************************************************

HsCD00045633      AAGACCCTCCTGGGGACCAAGCTGGAAGCCAAGTACCTGTGCTCCGCCTGCAGAAACGTC
NM_021138.3       AAGACCCTCCTGGGGACCAAGCTGGAAGCCAAGTACCTGTGCTCCGCCTGCAGAAACGTC
                  ************************************************************

HsCD00045633      CTCCGCAGGCCCTTCCAGGCGCAGTGTGGCCACCGGTACTGCTCCTTCTGCCTGGCCAGC
NM_021138.3       CTCCGCAGGCCCTTCCAGGCGCAGTGTGGCCACCGGTACTGCTCCTTCTGCCTGGCCAGC
                  ************************************************************

HsCD00045633      ATCCTCAGCTCTGGGCCTCAGAACTGTGCTGCCTGTGTTCACGAGGGCATATATGAAGAA
NM_021138.3       ATCCTCAGCTCTGGGCCTCAGAACTGTGCTGCCTGTGTTCACGAGGGCATATATGAAGAA
                  ************************************************************

HsCD00045633      GGCATTTCTATTTTAGAAAGCAGTTCGGCCTTCCCAGATAATGCTGCCCGCAGGGAGGTG
NM_021138.3       GGCATTTCTATTTTAGAAAGCAGTTCGGCCTTCCCAGATAATGCTGCCCGCAGGGAGGTG
                  ************************************************************

HsCD00045633      GAGAGCCTGCCGGCCGTCTGTCCCAGTGATGGATGCACCTGGAAGGGGACCCTGAAAGAA
NM_021138.3       GAGAGCCTGCCGGCCGTCTGTCCCAGTGATGGATGCACCTGGAAGGGGACCCTGAAAGAA
                  ************************************************************

HsCD00045633      TACGAGAGCTGCCACGAAGGCCGCTGCCCGCTCATGCTGACCGAATGTCCCGCGTGCAAA
NM_021138.3       TACGAGAGCTGCCACGAAGGCCGCTGCCCGCTCATGCTGACCGAATGTCCCGCGTGCAAA
                  ************************************************************

HsCD00045633      GGCCTGGTCCGCCTTGGTGAAAAGGAGCGCCACCTGGAGCACGAGTGCCCGGAGAGAAGC
NM_021138.3       GGCCTGGTCCGCCTTGGTGAAAAGGAGCGCCACCTGGAGCACGAGTGCCCGGAGAGAAGC
                  ************************************************************

HsCD00045633      CTGAGCTGCCGGCATTGCCGGGCACCCTGCTGCGGAGCAGACGTGAAGGCGCACCACGAG
NM_021138.3       CTGAGCTGCCGGCATTGCCGGGCACCCTGCTGCGGAGCAGACGTGAAGGCGCACCACGAG
                  ************************************************************

HsCD00045633      GTCTGCCCCAAGTTCCCCTTAACTTGTGACGGCTGCGGCAAGAAGAAGATCCCCCGGGAG
NM_021138.3       GTCTGCCCCAAGTTCCCCTTAACTTGTGACGGCTGCGGCAAGAAGAAGATCCCCCGGGAG
                  ************************************************************

HsCD00045633      AAGTTTCAGGACCACGTCAAGACTTGTGGCAAGTGTCGAGTCCCTTGCAGATTCCACGCC
NM_021138.3       AAGTTTCAGGACCACGTCAAGACTTGTGGCAAGTGTCGAGTCCCTTGCAGATTCCACGCC
                  ************************************************************

HsCD00045633      ATCGGCTGCCTCGAGACGGTAGAGGGTGAGAAACAGCAGGAGCACGAGGTGCAGTGGCTG
NM_021138.3       ATCGGCTGCCTCGAGACGGTAGAGGGTGAGAAACAGCAGGAGCACGAGGTGCAGTGGCTG
                  ************************************************************

HsCD00045633      CGGGAGCACCTGGCCATGCTACTGAGCTCGGTGCTGGAGGCAAAGCCCCTCTTGGGAGAC
NM_021138.3       CGGGAGCACCTGGCCATGCTACTGAGCTCGGTGCTGGAGGCAAAGCCCCTCTTGGGAGAC
                  ************************************************************

HsCD00045633      CAGAGCCACGCGGGGTCAGAGCTCCTGCAGAGGTGCGAGAGCCTGGAGAAGAAGACGGCC
NM_021138.3       CAGAGCCACGCGGGGTCAGAGCTCCTGCAGAGGTGCGAGAGCCTGGAGAAGAAGACGGCC
                  ************************************************************

HsCD00045633      ACTTTTGAGAACATTGTCTGCGTCCTGAACCGGGAGGTGGAGAGGGTGGCCATGACTGCC
NM_021138.3       ACTTTTGAGAACATTGTCTGCGTCCTGAACCGGGAGGTGGAGAGGGTGGCCATGACTGCC
                  ************************************************************

HsCD00045633      GAGGCCTGCAGCCGGCAGCACCGGCTGGACCAAGACAAGATTGAAGCCCTGAGTAGCAAG
NM_021138.3       GAGGCCTGCAGCCGGCAGCACCGGCTGGACCAAGACAAGATTGAAGCCCTGAGTAGCAAG
                  ************************************************************

HsCD00045633      GTGCAGCAGCTGGAGAGGAGCATTGGCCTCAAGGACCTGGCGATGGCTGACTTGGAGCAG
NM_021138.3       GTGCAGCAGCTGGAGAGGAGCATTGGCCTCAAGGACCTGGCGATGGCTGACTTGGAGCAG
                  ************************************************************

HsCD00045633      AAGGTCTTGGAGATGGAGGCATCCACCTACGATGGGGTCTTCATCTGGAAGATCTCAGAC
NM_021138.3       AAGGTCTTGGAGATGGAGGCATCCACCTACGATGGGGTCTTCATCTGGAAGATCTCAGAC
                  ************************************************************

HsCD00045633      TTCGCCAGGAAGCGCCAGGAAGCTGTGGCTGGCCGCATACCCGCCATCTTCTCCCCAGCC
NM_021138.3       TTCGCCAGGAAGCGCCAGGAAGCTGTGGCTGGCCGCATACCCGCCATCTTCTCCCCAGCC
                  ************************************************************

HsCD00045633      TTCTACACCAGCAGGTACGGCTACAAGATGTGTCTGCGTATCTACCTGAACGGCGACGGC
NM_021138.3       TTCTACACCAGCAGGTACGGCTACAAGATGTGTCTGCGTATCTACCTGAACGGCGACGGC
                  ************************************************************

HsCD00045633      ACCGGGCGAGGAACACACCTGTCCCTCTTCTTTGTGGTGATGAAGGGCCCGAATGACGCC
NM_021138.3       ACCGGGCGAGGAACACACCTGTCCCTCTTCTTTGTGGTGATGAAGGGCCCGAATGACGCC
                  ************************************************************

HsCD00045633      CTGCTGCGGTGGCCCTTCAACCAGAAGGTGACCTTAATGCTGCTCGACCAGAATAACCGG
NM_021138.3       CTGCTGCGGTGGCCCTTCAACCAGAAGGTGACCTTAATGCTGCTCGACCAGAATAACCGG
                  ************************************************************

HsCD00045633      GAGCACGTGATTGACGCCTTCAGGCCCGACGTGACTTCATCCTCTTTTCAGAGGCCAGTC
NM_021138.3       GAGCACGTGATTGACGCCTTCAGGCCCGACGTGACTTCATCCTCTTTTCAGAGGCCAGTC
                  ************************************************************

HsCD00045633      AACGACATGAACATCGCAAGCGGCTGCCCCCTCTTCTGCCCCGTCTCCAAGATGGAGGCA
NM_021138.3       AACGACATGAACATCGCAAGCGGCTGCCCCCTCTTCTGCCCCGTCTCCAAGATGGAGGCA
                  ************************************************************

HsCD00045633      AAGAATTCCTACGTGCGGGACGATGCCATCTTCATCAAGGCCATTGTGGACCTGACAGGG
NM_021138.3       AAGAATTCCTACGTGCGGGACGATGCCATCTTCATCAAGGCCATTGTGGACCTGACAGGG
                  ************************************************************

HsCD00045633      CTCTAG
NM_021138.3       CTCTAA
                  *****.

Pathways

NCI : CD40/CD40L signaling
NCI : Caspase Cascade in Apoptosis
NCI : Ceramide signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : TNF receptor signaling pathway
NCI : TRAIL signaling pathway
NCI : p38 MAPK signaling pathway
Panther : Apoptosis signaling pathway
Panther : p53 pathway
Reactome : Apoptosis
Reactome : Caspase-8 activation
Reactome : Death Receptor Signalling
Reactome : Dimerization of procaspase-8
Reactome : Extrinsic Pathway for Apoptosis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulation by c-FLIP
Reactome : TNF signaling
Reactome : TRAF6 mediated IRF7 activation
Reactome : TRAF6 mediated NF-kB activation
WikiPathway : Apoptosis
WikiPathway : MAPK signaling pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : p38 MAPK Signaling Pathway

Protein

SMART domain : RING : Ring finger
SMART domain : MATH : meprin and TRAF homology
UniProt : Q12933
HPRD : 03538

Clone

Cloning Information : 182876
HIP Master Clone ID : 157820
Original Clone ID : FLH182876.01X

Organism


TAX_ID : 9606
Species Specific ID: 7186

Genome

Chromosome : 9
Map Location : 9q34
Ensembl : ENSG00000127191

Reagents

Labome : TRAF2-antibody