DNASU Plasmid Repository • 480.965.5697 | Email

TCEA1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TCEA1
Gene Name:  transcription elongation factor A (SII), 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH019812.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00000457

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 906nts        
Open reading frame : 1 to 906
Reference Sequence Alignment

ATGGAGGACGAAGTGGTCCGCTTTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAAC
GCGGCTGGAGCATTGGATTTGCTAAAGGAGCTTAAGAATATTCCTATGACCCTGGAATTA
CTGCAGTCCACAAGAATCGGAATGTCAGTTAATGCTATTCGCAAGCAGAGTACAGATGAG
GAAGTTACATCTTTGGCAAAGTCTCTCATCAAATCCTGGAAAAAATTATTAGATGGGCCA
TCAACTGAGAAAGACCTTGACGAAAAGAAGAAAGAACCTGCAATTACATCGCAGAACAGC
CCTGAGGCAAGAGAAGAAAGTACTTCCAGCGGCAATGTAAGCAACAGAAAGGATGAGACA
AATGCTCGAGATACTTATGTTTCATCCTTTCCTCGGGCACCAAGCACTTCTGATTCTGTG
CGGTTGAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGGGATGACTACATTGCA
ATTGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAAGAAGCTATATATCAAGAAATA
AGGAATACAGACATGAAATACAAAAATAGAGTACGAAGTAGGATATCAAATCTTAAAGAT
GCAAAAAATCCAAATTTAAGGAAAAATGTCCTCTGTGGGAATATTCCTCCTGACTTATTT
GCTAGAATGACAGCAGAGGAAATGGCTAGTGATGAGCTGAAAGAGATGCGGAAAAACTTG
ACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACTGGTGGGACCCAGACTGACTTG
TTCACATGTGGCAAATGTAAAAAGAAGAATTGCACTTACACACAGGTACAAACCCGTAGT
GCTGATGAACCAATGACAACATTTGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTC
TGTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1010
Start on reference sequence 105
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 9 42
recombination site loxP site loxP recombination site 1015 1048
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TCEA1
Symbol Nomenclature : TCEA1
SYNONYM : GTF2S; SII; TCEA; TF2S; TFIIS
Designation : transcription elongation factor A protein 1|transcription elongation factor S-II protein 1|transcription elongation factor TFIIS.o
Full Nomenclature : transcription elongation factor A (SII), 1
GENEID : 6917
GI : 61355861
GenBank Accession : AY888239
HGNC : 11612
MIM : 601425
Vega : OTTHUMG00000164262
Target GenBank: NM_006756

 

Reference Sequence Alignment

  

HsCD00000457      ATGGAGGACGAAGTGGTCCGCTTTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAAC
NM_006756.3       ATGGAGGACGAAGTGGTCCGCTTTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAAC
NM_201437.2       ATGGAGGACGAAGTGGTCCGCTTTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAAC
                  ************************************************************

HsCD00000457      GCGGCTGGAGCATTGGATTTGCTAAAGGAGCTTAAGAATATTCCTATGACCCTGGAATTA
NM_006756.3       GCGGCTGGAGCATTGGATTTGCTAAAGGAGCTTAAGAATATTCCTATGACCCTGGAATTA
NM_201437.2       GCG---------------------------------------------------------
                  ***                                                         

HsCD00000457      CTGCAGTCCACAAGAATCGGAATGTCAGTTAATGCTATTCGCAAGCAGAGTACAGATGAG
NM_006756.3       CTGCAGTCCACAAGAATCGGAATGTCAGTTAATGCTATTCGCAAGCAGAGTACAGATGAG
NM_201437.2       ------TCCACAAGAATCGGAATGTCAGTTAATGCTATTCGCAAGCAGAGTACAGATGAG
                        ******************************************************

HsCD00000457      GAAGTTACATCTTTGGCAAAGTCTCTCATCAAATCCTGGAAAAAATTATTAGATGGGCCA
NM_006756.3       GAAGTTACATCTTTGGCAAAGTCTCTCATCAAATCCTGGAAAAAATTATTAGATGGGCCA
NM_201437.2       GAAGTTACATCTTTGGCAAAGTCTCTCATCAAATCCTGGAAAAAATTATTAGATGGGCCA
                  ************************************************************

HsCD00000457      TCAACTGAGAAAGACCTTGACGAAAAGAAGAAAGAACCTGCAATTACATCGCAGAACAGC
NM_006756.3       TCAACTGAGAAAGACCTTGACGAAAAGAAGAAAGAACCTGCAATTACATCGCAGAACAGC
NM_201437.2       TCAACTGAGAAAGACCTTGACGAAAAGAAGAAAGAACCTGCAATTACATCGCAGAACAGC
                  ************************************************************

HsCD00000457      CCTGAGGCAAGAGAAGAAAGTACTTCCAGCGGCAATGTAAGCAACAGAAAGGATGAGACA
NM_006756.3       CCTGAGGCAAGAGAAGAAAGTACTTCCAGCGGCAATGTAAGCAACAGAAAGGATGAGACA
NM_201437.2       CCTGAGGCAAGAGAAGAAAGTACTTCCAGCGGCAATGTAAGCAACAGAAAGGATGAGACA
                  ************************************************************

HsCD00000457      AATGCTCGAGATACTTATGTTTCATCCTTTCCTCGGGCACCAAGCACTTCTGATTCTGTG
NM_006756.3       AATGCTCGAGATACTTATGTTTCATCCTTTCCTCGGGCACCAAGCACTTCTGATTCTGTG
NM_201437.2       AATGCTCGAGATACTTATGTTTCATCCTTTCCTCGGGCACCAAGCACTTCTGATTCTGTG
                  ************************************************************

HsCD00000457      CGGTTGAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGGGATGACTACATTGCA
NM_006756.3       CGGTTGAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGGGATGACTACATTGCA
NM_201437.2       CGGTTGAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGGGATGACTACATTGCA
                  ************************************************************

HsCD00000457      ATTGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAAGAAGCTATATATCAAGAAATA
NM_006756.3       ATTGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAAGAAGCTATATATCAAGAAATA
NM_201437.2       ATTGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAAGAAGCTATATATCAAGAAATA
                  ************************************************************

HsCD00000457      AGGAATACAGACATGAAATACAAAAATAGAGTACGAAGTAGGATATCAAATCTTAAAGAT
NM_006756.3       AGGAATACAGACATGAAATACAAAAATAGAGTACGAAGTAGGATATCAAATCTTAAAGAT
NM_201437.2       AGGAATACAGACATGAAATACAAAAATAGAGTACGAAGTAGGATATCAAATCTTAAAGAT
                  ************************************************************

HsCD00000457      GCAAAAAATCCAAATTTAAGGAAAAATGTCCTCTGTGGGAATATTCCTCCTGACTTATTT
NM_006756.3       GCAAAAAATCCAAATTTAAGGAAAAATGTCCTCTGTGGGAATATTCCTCCTGACTTATTT
NM_201437.2       GCAAAAAATCCAAATTTAAGGAAAAATGTCCTCTGTGGGAATATTCCTCCTGACTTATTT
                  ************************************************************

HsCD00000457      GCTAGAATGACAGCAGAGGAAATGGCTAGTGATGAGCTGAAAGAGATGCGGAAAAACTTG
NM_006756.3       GCTAGAATGACAGCAGAGGAAATGGCTAGTGATGAGCTGAAAGAGATGCGGAAAAACTTG
NM_201437.2       GCTAGAATGACAGCAGAGGAAATGGCTAGTGATGAGCTGAAAGAGATGCGGAAAAACTTG
                  ************************************************************

HsCD00000457      ACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACTGGTGGGACCCAGACTGACTTG
NM_006756.3       ACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACTGGTGGGACCCAGACTGACTTG
NM_201437.2       ACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACTGGTGGGACCCAGACTGACTTG
                  ************************************************************

HsCD00000457      TTCACATGTGGCAAATGTAAAAAGAAGAATTGCACTTACACACAGGTACAAACCCGTAGT
NM_006756.3       TTCACATGTGGCAAATGTAAAAAGAAGAATTGCACTTACACACAGGTACAAACCCGTAGT
NM_201437.2       TTCACATGTGGCAAATGTAAAAAGAAGAATTGCACTTACACACAGGTACAAACCCGTAGT
                  ************************************************************

HsCD00000457      GCTGATGAACCAATGACAACATTTGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTC
NM_006756.3       GCTGATGAACCAATGACAACATTTGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTC
NM_201437.2       GCTGATGAACCAATGACAACATTTGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTC
                  ************************************************************

HsCD00000457      TGTTAG
NM_006756.3       TGTTGA
NM_201437.2       TGTTGA
                  ****..

Pathways

Reactome : Disease
Reactome : DNA Repair
Reactome : Dual incision reaction in TC-NER
Reactome : Elongation arrest and recovery
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Formation of transcription-coupled NER (TC-NER) repair complex
Reactome : Gene Expression
Reactome : HIV elongation arrest and recovery
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : Late Phase of HIV Life Cycle
Reactome : Nucleotide Excision Repair
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcription-coupled NER (TC-NER)

Clone

Cloning Information : 19812
HIP Master Clone ID : 34322
Original Clone ID : FLH019812.01X

Organism


TAX_ID : 9606
Species Specific ID: 6917

Genome

Chromosome : 8
Map Location : 8q11.2
Ensembl : ENSG00000187735

Reagents

Labome : TCEA1-antibody