DNASU Plasmid Repository • 480.965.5697 | Email

CLTA (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CLTA
Gene Name:  clathrin, light chain A
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH024475.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00004722

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 657nts         Open reading frame : 1 to 657
Reference Sequence Alignment

ATGGCTGAGCTGGATCCGTTCGGCGCCCCTGCCGGCGCCCCTGGCGGTCCCGCGCTGGGG
AACGGAGTGGCCGGCGCCGGCGAAGAAGACCCGGCTGCGGCCTTCTTGGCGCAGCAAGAG
AGCGAGATTGCGGGCATCGAGAACGACGAGGCCTTCGCCATCCTGGACGGCGGCGCCCCC
GGGCCCCAGCCGCACGGCGAGCCGCCGGGGGGTCCGGATGCTGTTGATGGAGTAATGAAT
GGTGAATACTACCAGGAAAGTAATGGTCCAACAGACAGTTATGCAGCTATTTCACAAGTG
GATCGATTGCAGTCAGAGCCTGAAAGTATCCGTAAATGGAGAGAAGAACAAATGGAACGC
TTGGAAGCCCTTGATGCCAATTCTCGGAAGCAAGAAGCAGAGTGGAAAGAAAAGGCAATA
AAGGAGCTAGAAGAATGGTATGCAAGACAGGACGAGCAGCTACAGAAAACAAAAGCAAAC
AACAGGGCAGCAGAAGAAGCCTTTGTAAATGACATTGACGAGTCGTCCCCAGGCACTGAG
TGGGAACGGGTGGCCCGGCTGTGTGACTTTAACCCCAAGTCTAGCAAGCAGGCCAAAGAT
GTCTCCCGCATGCGCTCAGTCCTCATCTCCCTCAAGCAGGCCCCGCTGGTGCACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 746
Start on reference sequence 90
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CLTA
Symbol Nomenclature : CLTA
SYNONYM : LCA
Designation : clathrin light chain A|clathrin, light polypeptide (Lca)
Full Nomenclature : clathrin, light chain A
GENEID : 1211
GI : 60653990
GenBank Accession : AY892771
HGNC : 2090
MIM : 118960
Vega : OTTHUMG00000019896
Target GenBank: BC019287

 

Reference Sequence Alignment

  

HsCD00004722        ATGGCTGAGCTGGATCCGTTCGGCGCCCCTGCCGGCGCCCCTGGCGGTCCCGCGCTGGGG
NM_001076677.2      ATGGCTGAGCTGGATCCGTTCGGCGCCCCTGCCGGCGCCCCTGGCGGTCCCGCGCTGGGG
NM_001833.3         ATGGCTGAGCTGGATCCGTTCGGCGCCCCTGCCGGCGCCCCTGGCGGTCCCGCGCTGGGG
NM_001184760.1      ATGGCTGAGCTGGATCCGTTCGGCGCCCCTGCCGGCGCCCCTGGCGGTCCCGCGCTGGGG
                    ************************************************************

HsCD00004722        AACGGAGTGGCCGGCGCCGGCGAAGAAGACCCGGCTGCGGCCTTCTTGGCGCAGCAAGAG
NM_001076677.2      AACGGAGTGGCCGGCGCCGGCGAAGAAGACCCGGCTGCGGCCTTCTTGGCGCAGCAAGAG
NM_001833.3         AACGGAGTGGCCGGCGCCGGCGAAGAAGACCCGGCTGCGGCCTTCTTGGCGCAGCAAGAG
NM_001184760.1      AACGGAGTGGCCGGCGCCGGCGAAGAAGACCCGGCTGCGGCCTTCTTGGCGCAGCAAGAG
                    ************************************************************

HsCD00004722        AGCGAGATTGCGGGCATCGAGAACGACGAGGCCTTCGCCATCCTGGACGGCGGCGCCCCC
NM_001076677.2      AGCGAGATTGCGGGCATCGAGAACGACGAGGCCTTCGCCATCCTGGACGGCGGCGCCCCC
NM_001833.3         AGCGAGATTGCGGGCATCGAGAACGACGAGGCCTTCGCCATCCTGGACGGCGGCGCCCCC
NM_001184760.1      AGCGAGATTGCGGGCATCGAGAACGACGAGGCCTTCGCCATCCTGGACGGCGGCGCCCCC
                    ************************************************************

HsCD00004722        GGGCCCCAGCCGCACGGCGAGCCGCCGGGGGGTCCGGATGCTGTTGATGGAGTAATGAAT
NM_001076677.2      GGGCCCCAGCCGCACGGCGAGCCGCCGGGGGGTCCGGATGCTGTTGATGGAGTAATGAAT
NM_001833.3         GGGCCCCAGCCGCACGGCGAGCCGCCGGGGGGTCCGGATGCTGTTGATGGAGTAATGAAT
NM_001184760.1      GGGCCCCAGCCGCACGGCGAGCCGCCGGGGGGTCCGGATGCTGTTGATGGAGTAATGAAT
                    ************************************************************

HsCD00004722        GGTGAATACTACCAGGAAAGTAATGGTCCAACAGACAGTTATGCAGCTATTTCACAAGTG
NM_001076677.2      GGTGAATACTACCAGGAAAGTAATGGTCCAACAGACAGTTATGCAGCTATTTCACAAGTG
NM_001833.3         GGTGAATACTACCAGGAAAGTAATGGTCCAACAGACAGTTATGCAGCTATTTCACAAGTG
NM_001184760.1      GGTGAATACTACCAGGAAAGTAATGGTCCAACAGACAGTTATGCAGCTATTTCACAAGTG
                    ************************************************************

HsCD00004722        GATCGATTGCAGTCAGAGCCTGAAAGTATCCGTAAATGGAGAGAAGAACAAATGGAACGC
NM_001076677.2      GATCGATTGCAGTCAGAGCCTGAAAGTATCCGTAAATGGAGAGAAGAACAAATGGAACGC
NM_001833.3         GATCGATTGCAGTCAGAGCCTGAAAGTATCCGTAAATGGAGAGAAGAACAAATGGAACGC
NM_001184760.1      GATCGATTGCAGTCAGAGCCTGAAAGTATCCGTAAATGGAGAGAAGAACAAATGGAACGC
                    ************************************************************

HsCD00004722        TTGGAAGCCCTTGATGCCAATTCTCGGAAGCAAGAAGCAGAGTGGAAAGAAAAGGCAATA
NM_001076677.2      TTGGAAGCCCTTGATGCCAATTCTCGGAAGCAAGAAGCAGAGTGGAAAGAAAAGGCAATA
NM_001833.3         TTGGAAGCCCTTGATGCCAATTCTCGGAAGCAAGAAGCAGAGTGGAAAGAAAAGGCAATA
NM_001184760.1      TTGGAAGCCCTTGATGCCAATTCTCGGAAGCAAGAAGCAGAGTGGAAAGAAAAGGCAATA
                    ************************************************************

HsCD00004722        AAGGAGCTAGAAGAATGGTATGCAAGACAGGACGAGCAGCTACAGAAAACAAAAGCAAAC
NM_001076677.2      AAGGAGCTAGAAGAATGGTATGCAAGACAGGACGAGCAGCTACAGAAAACAAAAGCAAAC
NM_001833.3         AAGGAGCTAGAAGAATGGTATGCAAGACAGGACGAGCAGCTACAGAAAACAAAAGCAAAC
NM_001184760.1      AAGGAGCTAGAAGAATGGTATGCAAGACAGGACGAGCAGCTACAGAAAACAAAAGCAAAC
                    ************************************************************

HsCD00004722        AACAGG------------------------------------------------------
NM_001076677.2      AACAGGGTGGCAGATGAAGCTTTCTACAAACAACCCTTCGCTGACGTGATTGGTTATGTG
NM_001833.3         AACAG------------------------------------------------------G
NM_001184760.1      AACAGCACA------------------AACATAAACCATCCTTGCTACAGCCTAGAACAG
                    *****                                                       

HsCD00004722        GCAGCAGAAGAAGCCTTTGTAAATGACATTGACGAGTCGTCCCCAGGCACTGAGTGGGAA
NM_001076677.2      GCAGCAGAAGAAGCCTTTGTAAATGACATTGACGAGTCGTCCCCAGGCACTGAGTGGGAA
NM_001833.3         GCAGCAGAAGAAGCCTTTGTAAATGACATTGACGAGTCGTCCCCAGGCACTGAGTGGGAA
NM_001184760.1      GCAGCAGAAGAAGCCTTTGTAAATGACATTGACGAGTCGTCCCCAGGCACTGAGTGGGAA
                    ************************************************************

HsCD00004722        CGGGTGGCCCGGCTGTGTGACTTTAACCCCAAGTCTAGCAAGCAGGCCAAAGATGTCTCC
NM_001076677.2      CGGGTGGCCCGGCTGTGTGACTTTAACCCCAAGTCTAGCAAGCAGGCCAAAGATGTCTCC
NM_001833.3         CGGGTGGCCCGGCTGTGTGACTTTAACCCCAAGTCTAGCAAGCAGGCCAAAGATGTCTCC
NM_001184760.1      CGGGTGGCCCGGCTGTGTGACTTTAACCCCAAGTCTAGCAAGCAGGCCAAAGATGTCTCC
                    ************************************************************

HsCD00004722        CGCATGCGCTCAGTCCTCATCTCCCTCAAGCAGGCCCCGCTGGTGCACTTG
NM_001076677.2      CGCATGCGCTCAGTCCTCATCTCCCTCAAGCAGGCCCCGCTGGTGCACTGA
NM_001833.3         CGCATGCGCTCAGTCCTCATCTCCCTCAAGCAGGCCCCGCTGGTGCACTGA
NM_001184760.1      CGCATGCGCTCAGTCCTCATCTCCCTCAAGCAGGCCCCGCTGGTGCACTGA
                    ************************************************* .

Pathways

NCI : Arf1 pathway
NCI : C-MYB transcription factor network
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : Clathrin derived vesicle budding
Reactome : Developmental Biology
Reactome : Disease
Reactome : EGFR downregulation
Reactome : Entry of Influenza Virion into Host Cell via Endocytosis
Reactome : Formation of annular gap junctions
Reactome : Gap junction degradation
Reactome : Gap junction trafficking
Reactome : Gap junction trafficking and regulation
Reactome : Golgi Associated Vesicle Biogenesis
Reactome : Immune System
Reactome : Influenza Infection
Reactome : Influenza Life Cycle
Reactome : L1CAM interactions
Reactome : Lysosome Vesicle Biogenesis
Reactome : MHC class II antigen presentation
Reactome : Membrane Trafficking
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : PCP/CE pathway
Reactome : Recycling pathway of L1
Reactome : Retrograde neurotrophin signalling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by Wnt
Reactome : Signalling by NGF
Reactome : WNT5A-dependent internalization of FZD2, FZD5 and ROR2
Reactome : WNT5A-dependent internalization of FZD4
Reactome : beta-catenin independent WNT signaling
Reactome : trans-Golgi Network Vesicle Budding

Protein

UniProt : B4DIN1
UniProt : P09496
HPRD : 00351

Clone

Cloning Information : 24475
HIP Master Clone ID : 54851
Original Clone ID : FLH024475.01L

Organism


TAX_ID : 9606
Species Specific ID: 1211

Genome

Chromosome : 9
Map Location : 9p13
Ensembl : ENSG00000122705

Reagents

Labome : CLTA-antibody