DNASU Plasmid Repository • 480.965.5697 | Email

ASNS (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ASNS
Gene Name:  asparagine synthetase (glutamine-hydrolyzing)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH024640.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00004743

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1686nts         Open reading frame : 1 to 1686
Reference Sequence Alignment

ATGTGTGGCATTTGGGCGCTGTTTGGCAGTGATGATTGCCTTTCTGTTCAGTGTCTGAGT
GCTATGAAGATTGCACACAGAGGTCCAGATGCATTCCGTTTTGAGAATGTCAATGGATAC
ACCAACTGCTGCTTTGGATTTCACCGGTTGGCGGTAGTTGACCCGCTGTTTGGAATGCAG
CCAATTCGAGTGAAGAAATATCCGTATTTGTGGCTCTGTTACAATGGTGAAATCTACAAC
CATAAGAAGATGCAACAGCATTTTGAATTTGAATACCAGACCAAAGTGGATGGTGAGATA
ATCCTTCATCTTTATGACAAAGGAGGAATTGAGCAAACAATTTGTATGTTGGATGGTGTG
TTTGCATTTGTTTTACTGGATACTGCCAATAAGAAAGTGTTCCTGGGTAGAGATACATAT
GGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCTGTATGTTCAGAA
GCTAAAGGTCTTGTTACATTGAAGCACTCCGCGACTCCCTTTTTAAAAGTGGAGCCTTTT
CTTCCTGGACACTATGAAGTTTTGGATTTAAAGCCAAATGGCAAAGTTGCATCCGTGGAA
ATGGTTAAATATCATCACTGTCGGGATGTACCCCTGCACGCCCTCTATGACAATGTGGAG
AAACTCTTTCCAGGTTTTGAGATAGAAACTGTGAAGAACAACCTCAGGATCCTTTTTAAT
AATGCTGTAAAGAAACGTTTGATGACAGACAGAAGGATTGGCTGCCTTTTATCAGGGGGC
TTGGACTCCAGCTTGGTTGCTGCCACTCTGTTGAAGCAGCTGAAAGAAGCCCAAGTACAG
TATCCTCTCCAGACATTTGCAATTGGCATGGAAGACAGCCCCGATTTACTGGCTGCTAGA
AAGGTGGCAGATCATATTGGAAGTGAACATTATGAAGTCCTTTTTAACTCTGAGGAAGGC
ATTCAGGCTCTGGATGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTTCGT
GCTTCAGTAGGTATGTATTTAATTTCCAAGTATATTCGGAAGAACACAGATAGCGTGGTG
ATCTTCTCTGGAGAAGGATCAGATGAACTTACGCAGGGTTACATATATTTTCACAAGGCT
CCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAGGGAACTCTATTTGTTT
GATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGTCTTGAACTGAGAGTCCCATTT
CTAGATCATCGATTTTCTTCCTATTACTTGTCTCTGCCACCAGAAATGAGAATTCCAAAG
AATGGGATAGAAAAACATCTCCTGAGAGAGACGTTTGAGGATTCCAATCTGATACCCAAA
GAGATTCTCTGGCGACCAAAAGAAGCCTTCAGTGATGGAATAACTTCAGTTAAGAATTCC
TGGTTTAAGATTTTACAGGAATACGTTGAACATCAGGTTGATGATGCAATGATGGCAAAT
GCAGCCCAGAAATTTCCCTTCAATACTCCTAAAACCAAAGAAGGATATTACTACCGTCAA
GTCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGAGCCATTACTGGATGCCCAAG
TGGATCAATGCCACTGACCCTTCTGCCCGCACGCTGACCCACTACAAGTCAGCTGTCAAA
GCTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1822
Start on reference sequence 137
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ASNS
Symbol Nomenclature : ASNS
SYNONYM : ASNSD; TS11
Designation : TS11 cell cycle control protein|asparagine synthetase [glutamine-hydrolyzing]|glutamine-dependent asparagine synthetase
Full Nomenclature : asparagine synthetase (glutamine-hydrolyzing)
GENEID : 440
GI : 60654008
GenBank Accession : AY892780
HGNC : 753
MIM : 108370
Vega : OTTHUMG00000022892
Target GenBank: BC014621

 

Reference Sequence Alignment

  

HsCD00004743        ATGTGTGGCATTTGGGCGCTGTTTGGCAGTGATGATTGCCTTTCTGTTCAGTGTCTGAGT
NM_133436.3         ATGTGTGGCATTTGGGCGCTGTTTGGCAGTGATGATTGCCTTTCTGTTCAGTGTCTGAGT
NM_001673.4         ATGTGTGGCATTTGGGCGCTGTTTGGCAGTGATGATTGCCTTTCTGTTCAGTGTCTGAGT
NM_183356.3         ATGTGTGGCATTTGGGCGCTGTTTGGCAGTGATGATTGCCTTTCTGTTCAGTGTCTGAGT
NM_001178075.1      ------------------------------------------------------------
                                                                                

HsCD00004743        GCTATGAAGATTGCACACAGAGGTCCAGATGCATTCCGTTTTGAGAATGTCAATGGATAC
NM_133436.3         GCTATGAAGATTGCACACAGAGGTCCAGATGCATTCCGTTTTGAGAATGTCAATGGATAC
NM_001673.4         GCTATGAAGATTGCACACAGAGGTCCAGATGCATTCCGTTTTGAGAATGTCAATGGATAC
NM_183356.3         GCTATGAAGATTGCACACAGAGGTCCAGATGCATTCCGTTTTGAGAATGTCAATGGATAC
NM_001178075.1      ---ATGAAGATTGCACACAGAGGTCCAGATGCATTCCGTTTTGAGAATGTCAATGGATAC
                       *********************************************************

HsCD00004743        ACCAACTGCTGCTTTGGATTTCACCGGTTGGCGGTAGTTGACCCGCTGTTTGGAATGCAG
NM_133436.3         ACCAACTGCTGCTTTGGATTTCACCGGTTGGCGGTAGTTGACCCGCTGTTTGGAATGCAG
NM_001673.4         ACCAACTGCTGCTTTGGATTTCACCGGTTGGCGGTAGTTGACCCGCTGTTTGGAATGCAG
NM_183356.3         ACCAACTGCTGCTTTGGATTTCACCGGTTGGCGGTAGTTGACCCGCTGTTTGGAATGCAG
NM_001178075.1      ACCAACTGCTGCTTTGGATTTCACCGGTTGGCGGTAGTTGACCCGCTGTTTGGAATGCAG
                    ************************************************************

HsCD00004743        CCAATTCGAGTGAAGAAATATCCGTATTTGTGGCTCTGTTACAATGGTGAAATCTACAAC
NM_133436.3         CCAATTCGAGTGAAGAAATATCCGTATTTGTGGCTCTGTTACAATGGTGAAATCTACAAC
NM_001673.4         CCAATTCGAGTGAAGAAATATCCGTATTTGTGGCTCTGTTACAATGGTGAAATCTACAAC
NM_183356.3         CCAATTCGAGTGAAGAAATATCCGTATTTGTGGCTCTGTTACAATGGTGAAATCTACAAC
NM_001178075.1      CCAATTCGAGTGAAGAAATATCCGTATTTGTGGCTCTGTTACAATGGTGAAATCTACAAC
                    ************************************************************

HsCD00004743        CATAAGAAGATGCAACAGCATTTTGAATTTGAATACCAGACCAAAGTGGATGGTGAGATA
NM_133436.3         CATAAGAAGATGCAACAGCATTTTGAATTTGAATACCAGACCAAAGTGGATGGTGAGATA
NM_001673.4         CATAAGAAGATGCAACAGCATTTTGAATTTGAATACCAGACCAAAGTGGATGGTGAGATA
NM_183356.3         CATAAGAAGATGCAACAGCATTTTGAATTTGAATACCAGACCAAAGTGGATGGTGAGATA
NM_001178075.1      CATAAGAAGATGCAACAGCATTTTGAATTTGAATACCAGACCAAAGTGGATGGTGAGATA
                    ************************************************************

HsCD00004743        ATCCTTCATCTTTATGACAAAGGAGGAATTGAGCAAACAATTTGTATGTTGGATGGTGTG
NM_133436.3         ATCCTTCATCTTTATGACAAAGGAGGAATTGAGCAAACAATTTGTATGTTGGATGGTGTG
NM_001673.4         ATCCTTCATCTTTATGACAAAGGAGGAATTGAGCAAACAATTTGTATGTTGGATGGTGTG
NM_183356.3         ATCCTTCATCTTTATGACAAAGGAGGAATTGAGCAAACAATTTGTATGTTGGATGGTGTG
NM_001178075.1      ATCCTTCATCTTTATGACAAAGGAGGAATTGAGCAAACAATTTGTATGTTGGATGGTGTG
                    ************************************************************

HsCD00004743        TTTGCATTTGTTTTACTGGATACTGCCAATAAGAAAGTGTTCCTGGGTAGAGATACATAT
NM_133436.3         TTTGCATTTGTTTTACTGGATACTGCCAATAAGAAAGTGTTCCTGGGTAGAGATACATAT
NM_001673.4         TTTGCATTTGTTTTACTGGATACTGCCAATAAGAAAGTGTTCCTGGGTAGAGATACATAT
NM_183356.3         TTTGCATTTGTTTTACTGGATACTGCCAATAAGAAAGTGTTCCTGGGTAGAGATACATAT
NM_001178075.1      TTTGCATTTGTTTTACTGGATACTGCCAATAAGAAAGTGTTCCTGGGTAGAGATACATAT
                    ************************************************************

HsCD00004743        GGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCTGTATGTTCAGAA
NM_133436.3         GGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCTGTATGTTCAGAA
NM_001673.4         GGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCTGTATGTTCAGAA
NM_183356.3         GGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCTGTATGTTCAGAA
NM_001178075.1      GGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCTGTATGTTCAGAA
                    ************************************************************

HsCD00004743        GCTAAAGGTCTTGTTACATTGAAGCACTCCGCGACTCCCTTTTTAAAAGTGGAGCCTTTT
NM_133436.3         GCTAAAGGTCTTGTTACATTGAAGCACTCCGCGACTCCCTTTTTAAAAGTGGAGCCTTTT
NM_001673.4         GCTAAAGGTCTTGTTACATTGAAGCACTCCGCGACTCCCTTTTTAAAAGTGGAGCCTTTT
NM_183356.3         GCTAAAGGTCTTGTTACATTGAAGCACTCCGCGACTCCCTTTTTAAAAGTGGAGCCTTTT
NM_001178075.1      GCTAAAGGTCTTGTTACATTGAAGCACTCCGCGACTCCCTTTTTAAAAGTGGAGCCTTTT
                    ************************************************************

HsCD00004743        CTTCCTGGACACTATGAAGTTTTGGATTTAAAGCCAAATGGCAAAGTTGCATCCGTGGAA
NM_133436.3         CTTCCTGGACACTATGAAGTTTTGGATTTAAAGCCAAATGGCAAAGTTGCATCCGTGGAA
NM_001673.4         CTTCCTGGACACTATGAAGTTTTGGATTTAAAGCCAAATGGCAAAGTTGCATCCGTGGAA
NM_183356.3         CTTCCTGGACACTATGAAGTTTTGGATTTAAAGCCAAATGGCAAAGTTGCATCCGTGGAA
NM_001178075.1      CTTCCTGGACACTATGAAGTTTTGGATTTAAAGCCAAATGGCAAAGTTGCATCCGTGGAA
                    ************************************************************

HsCD00004743        ATGGTTAAATATCATCACTGTCGGGATGTACCCCTGCACGCCCTCTATGACAATGTGGAG
NM_133436.3         ATGGTTAAATATCATCACTGTCGGGATGTACCCCTGCACGCCCTCTATGACAATGTGGAG
NM_001673.4         ATGGTTAAATATCATCACTGTCGGGATGTACCCCTGCACGCCCTCTATGACAATGTGGAG
NM_183356.3         ATGGTTAAATATCATCACTGTCGGGATGTACCCCTGCACGCCCTCTATGACAATGTGGAG
NM_001178075.1      ATGGTTAAATATCATCACTGTCGGGATGTACCCCTGCACGCCCTCTATGACAATGTGGAG
                    ************************************************************

HsCD00004743        AAACTCTTTCCAGGTTTTGAGATAGAAACTGTGAAGAACAACCTCAGGATCCTTTTTAAT
NM_133436.3         AAACTCTTTCCAGGTTTTGAGATAGAAACTGTGAAGAACAACCTCAGGATCCTTTTTAAT
NM_001673.4         AAACTCTTTCCAGGTTTTGAGATAGAAACTGTGAAGAACAACCTCAGGATCCTTTTTAAT
NM_183356.3         AAACTCTTTCCAGGTTTTGAGATAGAAACTGTGAAGAACAACCTCAGGATCCTTTTTAAT
NM_001178075.1      AAACTCTTTCCAGGTTTTGAGATAGAAACTGTGAAGAACAACCTCAGGATCCTTTTTAAT
                    ************************************************************

HsCD00004743        AATGCTGTAAAGAAACGTTTGATGACAGACAGAAGGATTGGCTGCCTTTTATCAGGGGGC
NM_133436.3         AATGCTGTAAAGAAACGTTTGATGACAGACAGAAGGATTGGCTGCCTTTTATCAGGGGGC
NM_001673.4         AATGCTGTAAAGAAACGTTTGATGACAGACAGAAGGATTGGCTGCCTTTTATCAGGGGGC
NM_183356.3         AATGCTGTAAAGAAACGTTTGATGACAGACAGAAGGATTGGCTGCCTTTTATCAGGGGGC
NM_001178075.1      AATGCTGTAAAGAAACGTTTGATGACAGACAGAAGGATTGGCTGCCTTTTATCAGGGGGC
                    ************************************************************

HsCD00004743        TTGGACTCCAGCTTGGTTGCTGCCACTCTGTTGAAGCAGCTGAAAGAAGCCCAAGTACAG
NM_133436.3         TTGGACTCCAGCTTGGTTGCTGCCACTCTGTTGAAGCAGCTGAAAGAAGCCCAAGTACAG
NM_001673.4         TTGGACTCCAGCTTGGTTGCTGCCACTCTGTTGAAGCAGCTGAAAGAAGCCCAAGTACAG
NM_183356.3         TTGGACTCCAGCTTGGTTGCTGCCACTCTGTTGAAGCAGCTGAAAGAAGCCCAAGTACAG
NM_001178075.1      TTGGACTCCAGCTTGGTTGCTGCCACTCTGTTGAAGCAGCTGAAAGAAGCCCAAGTACAG
                    ************************************************************

HsCD00004743        TATCCTCTCCAGACATTTGCAATTGGCATGGAAGACAGCCCCGATTTACTGGCTGCTAGA
NM_133436.3         TATCCTCTCCAGACATTTGCAATTGGCATGGAAGACAGCCCCGATTTACTGGCTGCTAGA
NM_001673.4         TATCCTCTCCAGACATTTGCAATTGGCATGGAAGACAGCCCCGATTTACTGGCTGCTAGA
NM_183356.3         TATCCTCTCCAGACATTTGCAATTGGCATGGAAGACAGCCCCGATTTACTGGCTGCTAGA
NM_001178075.1      TATCCTCTCCAGACATTTGCAATTGGCATGGAAGACAGCCCCGATTTACTGGCTGCTAGA
                    ************************************************************

HsCD00004743        AAGGTGGCAGATCATATTGGAAGTGAACATTATGAAGTCCTTTTTAACTCTGAGGAAGGC
NM_133436.3         AAGGTGGCAGATCATATTGGAAGTGAACATTATGAAGTCCTTTTTAACTCTGAGGAAGGC
NM_001673.4         AAGGTGGCAGATCATATTGGAAGTGAACATTATGAAGTCCTTTTTAACTCTGAGGAAGGC
NM_183356.3         AAGGTGGCAGATCATATTGGAAGTGAACATTATGAAGTCCTTTTTAACTCTGAGGAAGGC
NM_001178075.1      AAGGTGGCAGATCATATTGGAAGTGAACATTATGAAGTCCTTTTTAACTCTGAGGAAGGC
                    ************************************************************

HsCD00004743        ATTCAGGCTCTGGATGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTTCGT
NM_133436.3         ATTCAGGCTCTGGATGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTTCGT
NM_001673.4         ATTCAGGCTCTGGATGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTTCGT
NM_183356.3         ATTCAGGCTCTGGATGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTTCGT
NM_001178075.1      ATTCAGGCTCTGGATGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTTCGT
                    ************************************************************

HsCD00004743        GCTTCAGTAGGTATGTATTTAATTTCCAAGTATATTCGGAAGAACACAGATAGCGTGGTG
NM_133436.3         GCTTCAGTAGGTATGTATTTAATTTCCAAGTATATTCGGAAGAACACAGATAGCGTGGTG
NM_001673.4         GCTTCAGTAGGTATGTATTTAATTTCCAAGTATATTCGGAAGAACACAGATAGCGTGGTG
NM_183356.3         GCTTCAGTAGGTATGTATTTAATTTCCAAGTATATTCGGAAGAACACAGATAGCGTGGTG
NM_001178075.1      GCTTCAGTAGGTATGTATTTAATTTCCAAGTATATTCGGAAGAACACAGATAGCGTGGTG
                    ************************************************************

HsCD00004743        ATCTTCTCTGGAGAAGGATCAGATGAACTTACGCAGGGTTACATATATTTTCACAAGGCT
NM_133436.3         ATCTTCTCTGGAGAAGGATCAGATGAACTTACGCAGGGTTACATATATTTTCACAAGGCT
NM_001673.4         ATCTTCTCTGGAGAAGGATCAGATGAACTTACGCAGGGTTACATATATTTTCACAAGGCT
NM_183356.3         ATCTTCTCTGGAGAAGGATCAGATGAACTTACGCAGGGTTACATATATTTTCACAAGGCT
NM_001178075.1      ATCTTCTCTGGAGAAGGATCAGATGAACTTACGCAGGGTTACATATATTTTCACAAGGCT
                    ************************************************************

HsCD00004743        CCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAGGGAACTCTATTTGTTT
NM_133436.3         CCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAGGGAACTCTATTTGTTT
NM_001673.4         CCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAGGGAACTCTATTTGTTT
NM_183356.3         CCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAGGGAACTCTATTTGTTT
NM_001178075.1      CCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAGGGAACTCTATTTGTTT
                    ************************************************************

HsCD00004743        GATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGTCTTGAACTGAGAGTCCCATTT
NM_133436.3         GATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGTCTTGAACTGAGAGTCCCATTT
NM_001673.4         GATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGTCTTGAACTGAGAGTCCCATTT
NM_183356.3         GATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGTCTTGAACTGAGAGTCCCATTT
NM_001178075.1      GATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGTCTTGAACTGAGAGTCCCATTT
                    ************************************************************

HsCD00004743        CTAGATCATCGATTTTCTTCCTATTACTTGTCTCTGCCACCAGAAATGAGAATTCCAAAG
NM_133436.3         CTAGATCATCGATTTTCTTCCTATTACTTGTCTCTGCCACCAGAAATGAGAATTCCAAAG
NM_001673.4         CTAGATCATCGATTTTCTTCCTATTACTTGTCTCTGCCACCAGAAATGAGAATTCCAAAG
NM_183356.3         CTAGATCATCGATTTTCTTCCTATTACTTGTCTCTGCCACCAGAAATGAGAATTCCAAAG
NM_001178075.1      CTAGATCATCGATTTTCTTCCTATTACTTGTCTCTGCCACCAGAAATGAGAATTCCAAAG
                    ************************************************************

HsCD00004743        AATGGGATAGAAAAACATCTCCTGAGAGAGACGTTTGAGGATTCCAATCTGATACCCAAA
NM_133436.3         AATGGGATAGAAAAACATCTCCTGAGAGAGACGTTTGAGGATTCCAATCTGATACCCAAA
NM_001673.4         AATGGGATAGAAAAACATCTCCTGAGAGAGACGTTTGAGGATTCCAATCTGATACCCAAA
NM_183356.3         AATGGGATAGAAAAACATCTCCTGAGAGAGACGTTTGAGGATTCCAATCTGATACCCAAA
NM_001178075.1      AATGGGATAGAAAAACATCTCCTGAGAGAGACGTTTGAGGATTCCAATCTGATACCCAAA
                    ************************************************************

HsCD00004743        GAGATTCTCTGGCGACCAAAAGAAGCCTTCAGTGATGGAATAACTTCAGTTAAGAATTCC
NM_133436.3         GAGATTCTCTGGCGACCAAAAGAAGCCTTCAGTGATGGAATAACTTCAGTTAAGAATTCC
NM_001673.4         GAGATTCTCTGGCGACCAAAAGAAGCCTTCAGTGATGGAATAACTTCAGTTAAGAATTCC
NM_183356.3         GAGATTCTCTGGCGACCAAAAGAAGCCTTCAGTGATGGAATAACTTCAGTTAAGAATTCC
NM_001178075.1      GAGATTCTCTGGCGACCAAAAGAAGCCTTCAGTGATGGAATAACTTCAGTTAAGAATTCC
                    ************************************************************

HsCD00004743        TGGTTTAAGATTTTACAGGAATACGTTGAACATCAGGTTGATGATGCAATGATGGCAAAT
NM_133436.3         TGGTTTAAGATTTTACAGGAATACGTTGAACATCAGGTTGATGATGCAATGATGGCAAAT
NM_001673.4         TGGTTTAAGATTTTACAGGAATACGTTGAACATCAGGTTGATGATGCAATGATGGCAAAT
NM_183356.3         TGGTTTAAGATTTTACAGGAATACGTTGAACATCAGGTTGATGATGCAATGATGGCAAAT
NM_001178075.1      TGGTTTAAGATTTTACAGGAATACGTTGAACATCAGGTTGATGATGCAATGATGGCAAAT
                    ************************************************************

HsCD00004743        GCAGCCCAGAAATTTCCCTTCAATACTCCTAAAACCAAAGAAGGATATTACTACCGTCAA
NM_133436.3         GCAGCCCAGAAATTTCCCTTCAATACTCCTAAAACCAAAGAAGGATATTACTACCGTCAA
NM_001673.4         GCAGCCCAGAAATTTCCCTTCAATACTCCTAAAACCAAAGAAGGATATTACTACCGTCAA
NM_183356.3         GCAGCCCAGAAATTTCCCTTCAATACTCCTAAAACCAAAGAAGGATATTACTACCGTCAA
NM_001178075.1      GCAGCCCAGAAATTTCCCTTCAATACTCCTAAAACCAAAGAAGGATATTACTACCGTCAA
                    ************************************************************

HsCD00004743        GTCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGAGCCATTACTGGATGCCCAAG
NM_133436.3         GTCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGAGCCATTACTGGATGCCCAAG
NM_001673.4         GTCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGAGCCATTACTGGATGCCCAAG
NM_183356.3         GTCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGAGCCATTACTGGATGCCCAAG
NM_001178075.1      GTCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGAGCCATTACTGGATGCCCAAG
                    ************************************************************

HsCD00004743        TGGATCAATGCCACTGACCCTTCTGCCCGCACGCTGACCCACTACAAGTCAGCTGTCAAA
NM_133436.3         TGGATCAATGCCACTGACCCTTCTGCCCGCACGCTGACCCACTACAAGTCAGCTGTCAAA
NM_001673.4         TGGATCAATGCCACTGACCCTTCTGCCCGCACGCTGACCCACTACAAGTCAGCTGTCAAA
NM_183356.3         TGGATCAATGCCACTGACCCTTCTGCCCGCACGCTGACCCACTACAAGTCAGCTGTCAAA
NM_001178075.1      TGGATCAATGCCACTGACCCTTCTGCCCGCACGCTGACCCACTACAAGTCAGCTGTCAAA
                    ************************************************************

HsCD00004743        GCTTTG
NM_133436.3         GCTTAG
NM_001673.4         GCTTAG
NM_183356.3         GCTTAG
NM_001178075.1      GCTTAG
                    ****:*

Pathways

Panther : Asparagine and aspartate biosynthesis
Reactome : ATF4 activates genes
Reactome : Amino acid synthesis and interconversion (transamination)
Reactome : Metabolism
Reactome : Metabolism of amino acids and derivatives
Reactome : Metabolism of proteins
Reactome : PERK regulates gene expression
Reactome : Unfolded Protein Response (UPR)

Protein

UniProt : B4DXZ1
UniProt : E9PCI3
UniProt : P08243
UniProt : E9PCX6
HPRD : 00153

Clone

Cloning Information : 24640
HIP Master Clone ID : 55016
Original Clone ID : FLH024640.01L

Organism


TAX_ID : 9606
Species Specific ID: 440

Genome

Chromosome : 7
Map Location : 7q21.3
Ensembl : ENSG00000070669