DNASU Plasmid Repository • 480.965.5697 | Email

HIF1A (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HIF1A
Gene Name:  hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH024883.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00004832

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2481nts         Open reading frame : 1 to 2481
Reference Sequence Alignment

ATGGAGGGCGCCGGCGGCGCGAACGACAAGAAAAAGATAAGTTCTGAACGTCGAAAAGAA
AAGTCTCGAGATGCAGCCAGATCTCGGCGAAGTAAAGAATCTGAAGTTTTTTATGAGCTT
GCTCATCAGTTGCCACTTCCACATAATGTGAGTTCGCATCTTGATAAGGCCTCTGTGATG
AGGCTTACCATCAGCTATTTGCGTGTGAGGAAACTTCTGGATGCTGGTGATTTGGATATT
GAAGATGACATGAAAGCACAGATGAATTGCTTTTATTTGAAAGCCTTGGATGGTTTTGTT
ATGGTTCTCACAGATGATGGTGACATGATTTACATTTCTGATAATGTGAACAAATACATG
GGATTAACTCAGTTTGAACTAACTGGACACAGTGTGTTTGATTTTACTCATCCATGTGAC
CATGAGGAAATGAGAGAAATGCTTACACACAGAAATGGCCTTGTGAAAAAGGGTAAAGAA
CAAAACACACAGCGAAGCTTTTTTCTCAGAATGAAGTGTACCCTAACTAGCCGAGGAAGA
ACTATGAACATAAAGTCTGCAACATGGAAGGTATTGCACTGCACAGGCCACATTCACGTA
TATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCTATGACCTGCTTG
GTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCTTTAGATAGCAAG
ACTTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGATGAAAGAATTACC
GAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTATGAATATTATCAT
GCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACTAAAGGACAAGTC
ACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGGGTTGAAACTCAA
GCAACTGTCATATATAACACCAAGAATTCTCAACCACAGTGCATTGTATGTGTGAATTAC
GTTGTGAGTGGTATTATTCAGCACGACTTGATTTTCTCCCTTCAACAAACAGAATGTGTC
CTTAAACCGGTTGAATCTTCAGATATGAAAATGACTCAGCTATTCACCAAAGTTGAATCA
GAAGATACAAGTAGCCTCTTTGACAAACTTAAGAAGGAACCTGATGCTTTAACTTTGCTG
GCCCCAGCCGCTGGAGACACAATCATATCTTTAGATTTTGGCAGCAACGACACAGAAACT
GATGACCAGCAACTTGAGGAAGTACCATTATATAATGATGTAATGCTCCCCTCACCCAAC
GAAAAATTACAGAATATAAATTTGGCAATGTCTCCATTACCCACCGCTGAAACGCCAAAG
CCACTTCGAAGTAGTGCTGACCCTGCACTCAATCAAGAAGTTGCATTAAAATTAGAACCA
AATCCAGAGTCACTGGAACTTTCTTTTACCATGCCCCAGATTCAGGATCAGACACCTAGT
CCTTCCGATGGAAGCACTAGACAAAGTTCACCTGAGCCTAATAGTCCCAGTGAATATTGT
TTTTATGTGGATAGTGATATGGTCAATGAATTCAAGTTGGAATTGGTAGAAAAACTTTTT
GCTGAAGACACAGAAGCAAAGAACCCATTTTCTACTCAGGACACAGATTTAGACTTGGAG
ATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCCTTCGATCAGTTG
TCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAAAGCACAGTTACA
GTATTCCAGCAGACTCAAATACAAGAACCTACTGCTAATGCCACCACTACCACTGCCACC
ACTGATGAATTAAAAACAGTGACAAAAGACCGTATGGAAGACATTAAAATATTGATTGCA
TCTCCATCTCCTACCCACATACATAAAGAAACTACTAGTGCCACATCATCACCATATAGA
GATACTCAAAGTCGGACAGCCTCACCAAACAGAGCAGGAAAAGGAGTCATAGAACAGACA
GAAAAATCTCATCCAAGAAGCCCTAACGTGTTATCTGTCGCTTTGAGTCAAAGAACTACA
GTTCCTGAGGAAGAACTAAATCCAAAGATACTAGCTTTGCAGAATGCTCAGAGAAAGCGA
AAAATGGAACATGATGGTTCACTTTTTCAAGCAGTAGGAATTGGAACATTATTACAGCAG
CCAGACGATCATGCAGCTACTACATCACTTTCTTGGAAACGTGTAAAAGGATGCAAATCT
AGTGAACAGAATGGAATGGAGCAAAAGACAATTATTTTAATACCCTCTGATTTAGCATGT
AGACTGCTGGGGCAATCAATGGATGAAAGTGGATTACCACAGCTGACCAGTTATGATTGT
GAAGTTAATGCTCCTATACAAGGCAGCAGAAACCTACTGCAGGGTGAAGAATTACTCAGA
GCTTTGGATCAAGTTAACTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2744
Start on reference sequence 264
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HIF1A
Symbol Nomenclature : HIF1A
SYNONYM : HIF-1A; HIF-1alpha; HIF1; HIF1-ALPHA; MOP1; PASD8; bHLHe78
Designation : ARNT interacting protein|ARNT-interacting protein|HIF-1-alpha|PAS domain-containing protein 8|basic-helix-loop-helix-PAS protein MOP1|class E basic helix-loop-helix protein 78|hypoxia-inducible factor 1 alpha isoform I.3|hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)|hypoxia-inducible factor 1-alpha|hypoxia-inducible factor1alpha|member of PAS protein 1|member of PAS superfamily 1
Full Nomenclature : hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
GENEID : 3091
GI : 61362864
GenBank Accession : AY890352
HGNC : 4910
MIM : 603348
Vega : OTTHUMG00000140344
Target GenBank: BC012527

 

Reference Sequence Alignment

  

HsCD00004832        ------------------------------------------------------------
NM_001243084.1      ATGAGCTCCCAATGTCGGAGTTTGGAAAACAAATTTGTCTTTTTAAAAGAAGGTCTAGGA
NM_001530.3         ------------------------------------------------------------
                                                                                

HsCD00004832        ------------ATGGAGGGCGCCGGCGGCGCGAACGACAAGAAAAAGATAAGTTCTGAA
NM_001243084.1      AACTCAAAACCTGAAGAATTGGAAGAAATCAGAATAGAAAATGGTAGGATAAGTTCTGAA
NM_001530.3         ------------ATGGAGGGCGCCGGCGGCGCGAACGACAAGAAAAAGATAAGTTCTGAA
                                .:.**.   *..*... *. .*:.**.** ..:*.*************

HsCD00004832        CGTCGAAAAGAAAAGTCTCGAGATGCAGCCAGATCTCGGCGAAGTAAAGAATCTGAAGTT
NM_001243084.1      CGTCGAAAAGAAAAGTCTCGAGATGCAGCCAGATCTCGGCGAAGTAAAGAATCTGAAGTT
NM_001530.3         CGTCGAAAAGAAAAGTCTCGAGATGCAGCCAGATCTCGGCGAAGTAAAGAATCTGAAGTT
                    ************************************************************

HsCD00004832        TTTTATGAGCTTGCTCATCAGTTGCCACTTCCACATAATGTGAGTTCGCATCTTGATAAG
NM_001243084.1      TTTTATGAGCTTGCTCATCAGTTGCCACTTCCACATAATGTGAGTTCGCATCTTGATAAG
NM_001530.3         TTTTATGAGCTTGCTCATCAGTTGCCACTTCCACATAATGTGAGTTCGCATCTTGATAAG
                    ************************************************************

HsCD00004832        GCCTCTGTGATGAGGCTTACCATCAGCTATTTGCGTGTGAGGAAACTTCTGGATGCTGGT
NM_001243084.1      GCCTCTGTGATGAGGCTTACCATCAGCTATTTGCGTGTGAGGAAACTTCTGGATGCTGGT
NM_001530.3         GCCTCTGTGATGAGGCTTACCATCAGCTATTTGCGTGTGAGGAAACTTCTGGATGCTGGT
                    ************************************************************

HsCD00004832        GATTTGGATATTGAAGATGACATGAAAGCACAGATGAATTGCTTTTATTTGAAAGCCTTG
NM_001243084.1      GATTTGGATATTGAAGATGACATGAAAGCACAGATGAATTGCTTTTATTTGAAAGCCTTG
NM_001530.3         GATTTGGATATTGAAGATGACATGAAAGCACAGATGAATTGCTTTTATTTGAAAGCCTTG
                    ************************************************************

HsCD00004832        GATGGTTTTGTTATGGTTCTCACAGATGATGGTGACATGATTTACATTTCTGATAATGTG
NM_001243084.1      GATGGTTTTGTTATGGTTCTCACAGATGATGGTGACATGATTTACATTTCTGATAATGTG
NM_001530.3         GATGGTTTTGTTATGGTTCTCACAGATGATGGTGACATGATTTACATTTCTGATAATGTG
                    ************************************************************

HsCD00004832        AACAAATACATGGGATTAACTCAGTTTGAACTAACTGGACACAGTGTGTTTGATTTTACT
NM_001243084.1      AACAAATACATGGGATTAACTCAGTTTGAACTAACTGGACACAGTGTGTTTGATTTTACT
NM_001530.3         AACAAATACATGGGATTAACTCAGTTTGAACTAACTGGACACAGTGTGTTTGATTTTACT
                    ************************************************************

HsCD00004832        CATCCATGTGACCATGAGGAAATGAGAGAAATGCTTACACACAGAAATGGCCTTGTGAAA
NM_001243084.1      CATCCATGTGACCATGAGGAAATGAGAGAAATGCTTACACACAGAAATGGCCTTGTGAAA
NM_001530.3         CATCCATGTGACCATGAGGAAATGAGAGAAATGCTTACACACAGAAATGGCCTTGTGAAA
                    ************************************************************

HsCD00004832        AAGGGTAAAGAACAAAACACACAGCGAAGCTTTTTTCTCAGAATGAAGTGTACCCTAACT
NM_001243084.1      AAGGGTAAAGAACAAAACACACAGCGAAGCTTTTTTCTCAGAATGAAGTGTACCCTAACT
NM_001530.3         AAGGGTAAAGAACAAAACACACAGCGAAGCTTTTTTCTCAGAATGAAGTGTACCCTAACT
                    ************************************************************

HsCD00004832        AGCCGAGGAAGAACTATGAACATAAAGTCTGCAACATGGAAGGTATTGCACTGCACAGGC
NM_001243084.1      AGCCGAGGAAGAACTATGAACATAAAGTCTGCAACATGGAAGGTATTGCACTGCACAGGC
NM_001530.3         AGCCGAGGAAGAACTATGAACATAAAGTCTGCAACATGGAAGGTATTGCACTGCACAGGC
                    ************************************************************

HsCD00004832        CACATTCACGTATATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCT
NM_001243084.1      CACATTCACGTATATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCT
NM_001530.3         CACATTCACGTATATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCT
                    ************************************************************

HsCD00004832        ATGACCTGCTTGGTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCT
NM_001243084.1      ATGACCTGCTTGGTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCT
NM_001530.3         ATGACCTGCTTGGTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCT
                    ************************************************************

HsCD00004832        TTAGATAGCAAGACTTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGAT
NM_001243084.1      TTAGATAGCAAGACTTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGAT
NM_001530.3         TTAGATAGCAAGACTTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGAT
                    ************************************************************

HsCD00004832        GAAAGAATTACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTAT
NM_001243084.1      GAAAGAATTACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTAT
NM_001530.3         GAAAGAATTACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTAT
                    ************************************************************

HsCD00004832        GAATATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACT
NM_001243084.1      GAATATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACT
NM_001530.3         GAATATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACT
                    ************************************************************

HsCD00004832        AAAGGACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGG
NM_001243084.1      AAAGGACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGG
NM_001530.3         AAAGGACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGG
                    ************************************************************

HsCD00004832        GTTGAAACTCAAGCAACTGTCATATATAACACCAAGAATTCTCAACCACAGTGCATTGTA
NM_001243084.1      GTTGAAACTCAAGCAACTGTCATATATAACACCAAGAATTCTCAACCACAGTGCATTGTA
NM_001530.3         GTTGAAACTCAAGCAACTGTCATATATAACACCAAGAATTCTCAACCACAGTGCATTGTA
                    ************************************************************

HsCD00004832        TGTGTGAATTACGTTGTGAGTGGTATTATTCAGCACGACTTGATTTTCTCCCTTCAACAA
NM_001243084.1      TGTGTGAATTACGTTGTGAGTGGTATTATTCAGCACGACTTGATTTTCTCCCTTCAACAA
NM_001530.3         TGTGTGAATTACGTTGTGAGTGGTATTATTCAGCACGACTTGATTTTCTCCCTTCAACAA
                    ************************************************************

HsCD00004832        ACAGAATGTGTCCTTAAACCGGTTGAATCTTCAGATATGAAAATGACTCAGCTATTCACC
NM_001243084.1      ACAGAATGTGTCCTTAAACCGGTTGAATCTTCAGATATGAAAATGACTCAGCTATTCACC
NM_001530.3         ACAGAATGTGTCCTTAAACCGGTTGAATCTTCAGATATGAAAATGACTCAGCTATTCACC
                    ************************************************************

HsCD00004832        AAAGTTGAATCAGAAGATACAAGTAGCCTCTTTGACAAACTTAAGAAGGAACCTGATGCT
NM_001243084.1      AAAGTTGAATCAGAAGATACAAGTAGCCTCTTTGACAAACTTAAGAAGGAACCTGATGCT
NM_001530.3         AAAGTTGAATCAGAAGATACAAGTAGCCTCTTTGACAAACTTAAGAAGGAACCTGATGCT
                    ************************************************************

HsCD00004832        TTAACTTTGCTGGCCCCAGCCGCTGGAGACACAATCATATCTTTAGATTTTGGCAGCAAC
NM_001243084.1      TTAACTTTGCTGGCCCCAGCCGCTGGAGACACAATCATATCTTTAGATTTTGGCAGCAAC
NM_001530.3         TTAACTTTGCTGGCCCCAGCCGCTGGAGACACAATCATATCTTTAGATTTTGGCAGCAAC
                    ************************************************************

HsCD00004832        GACACAGAAACTGATGACCAGCAACTTGAGGAAGTACCATTATATAATGATGTAATGCTC
NM_001243084.1      GACACAGAAACTGATGACCAGCAACTTGAGGAAGTACCATTATATAATGATGTAATGCTC
NM_001530.3         GACACAGAAACTGATGACCAGCAACTTGAGGAAGTACCATTATATAATGATGTAATGCTC
                    ************************************************************

HsCD00004832        CCCTCACCCAACGAAAAATTACAGAATATAAATTTGGCAATGTCTCCATTACCCACCGCT
NM_001243084.1      CCCTCACCCAACGAAAAATTACAGAATATAAATTTGGCAATGTCTCCATTACCCACCGCT
NM_001530.3         CCCTCACCCAACGAAAAATTACAGAATATAAATTTGGCAATGTCTCCATTACCCACCGCT
                    ************************************************************

HsCD00004832        GAAACGCCAAAGCCACTTCGAAGTAGTGCTGACCCTGCACTCAATCAAGAAGTTGCATTA
NM_001243084.1      GAAACGCCAAAGCCACTTCGAAGTAGTGCTGACCCTGCACTCAATCAAGAAGTTGCATTA
NM_001530.3         GAAACGCCAAAGCCACTTCGAAGTAGTGCTGACCCTGCACTCAATCAAGAAGTTGCATTA
                    ************************************************************

HsCD00004832        AAATTAGAACCAAATCCAGAGTCACTGGAACTTTCTTTTACCATGCCCCAGATTCAGGAT
NM_001243084.1      AAATTAGAACCAAATCCAGAGTCACTGGAACTTTCTTTTACCATGCCCCAGATTCAGGAT
NM_001530.3         AAATTAGAACCAAATCCAGAGTCACTGGAACTTTCTTTTACCATGCCCCAGATTCAGGAT
                    ************************************************************

HsCD00004832        CAGACACCTAGTCCTTCCGATGGAAGCACTAGACAAAGTTCACCTGAGCCTAATAGTCCC
NM_001243084.1      CAGACACCTAGTCCTTCCGATGGAAGCACTAGACAAAGTTCACCTGAGCCTAATAGTCCC
NM_001530.3         CAGACACCTAGTCCTTCCGATGGAAGCACTAGACAAAGTTCACCTGAGCCTAATAGTCCC
                    ************************************************************

HsCD00004832        AGTGAATATTGTTTTTATGTGGATAGTGATATGGTCAATGAATTCAAGTTGGAATTGGTA
NM_001243084.1      AGTGAATATTGTTTTTATGTGGATAGTGATATGGTCAATGAATTCAAGTTGGAATTGGTA
NM_001530.3         AGTGAATATTGTTTTTATGTGGATAGTGATATGGTCAATGAATTCAAGTTGGAATTGGTA
                    ************************************************************

HsCD00004832        GAAAAACTTTTTGCTGAAGACACAGAAGCAAAGAACCCATTTTCTACTCAGGACACAGAT
NM_001243084.1      GAAAAACTTTTTGCTGAAGACACAGAAGCAAAGAACCCATTTTCTACTCAGGACACAGAT
NM_001530.3         GAAAAACTTTTTGCTGAAGACACAGAAGCAAAGAACCCATTTTCTACTCAGGACACAGAT
                    ************************************************************

HsCD00004832        TTAGACTTGGAGATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCC
NM_001243084.1      TTAGACTTGGAGATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCC
NM_001530.3         TTAGACTTGGAGATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCC
                    ************************************************************

HsCD00004832        TTCGATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAA
NM_001243084.1      TTCGATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAA
NM_001530.3         TTCGATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAA
                    ************************************************************

HsCD00004832        AGCACAGTTACAGTATTCCAGCAGACTCAAATACAAGAACCTACTGCTAATGCCACCACT
NM_001243084.1      AGCACAGTTACAGTATTCCAGCAGACTCAAATACAAGAACCTACTGCTAATGCCACCACT
NM_001530.3         AGCACAGTTACAGTATTCCAGCAGACTCAAATACAAGAACCTACTGCTAATGCCACCACT
                    ************************************************************

HsCD00004832        ACCACTGCCACCACTGATGAATTAAAAACAGTGACAAAAGACCGTATGGAAGACATTAAA
NM_001243084.1      ACCACTGCCACCACTGATGAATTAAAAACAGTGACAAAAGACCGTATGGAAGACATTAAA
NM_001530.3         ACCACTGCCACCACTGATGAATTAAAAACAGTGACAAAAGACCGTATGGAAGACATTAAA
                    ************************************************************

HsCD00004832        ATATTGATTGCATCTCCATCTCCTACCCACATACATAAAGAAACTACTAGTGCCACATCA
NM_001243084.1      ATATTGATTGCATCTCCATCTCCTACCCACATACATAAAGAAACTACTAGTGCCACATCA
NM_001530.3         ATATTGATTGCATCTCCATCTCCTACCCACATACATAAAGAAACTACTAGTGCCACATCA
                    ************************************************************

HsCD00004832        TCACCATATAGAGATACTCAAAGTCGGACAGCCTCACCAAACAGAGCAGGAAAAGGAGTC
NM_001243084.1      TCACCATATAGAGATACTCAAAGTCGGACAGCCTCACCAAACAGAGCAGGAAAAGGAGTC
NM_001530.3         TCACCATATAGAGATACTCAAAGTCGGACAGCCTCACCAAACAGAGCAGGAAAAGGAGTC
                    ************************************************************

HsCD00004832        ATAGAACAGACAGAAAAATCTCATCCAAGAAGCCCTAACGTGTTATCTGTCGCTTTGAGT
NM_001243084.1      ATAGAACAGACAGAAAAATCTCATCCAAGAAGCCCTAACGTGTTATCTGTCGCTTTGAGT
NM_001530.3         ATAGAACAGACAGAAAAATCTCATCCAAGAAGCCCTAACGTGTTATCTGTCGCTTTGAGT
                    ************************************************************

HsCD00004832        CAAAGAACTACAGTTCCTGAGGAAGAACTAAATCCAAAGATACTAGCTTTGCAGAATGCT
NM_001243084.1      CAAAGAACTACAGTTCCTGAGGAAGAACTAAATCCAAAGATACTAGCTTTGCAGAATGCT
NM_001530.3         CAAAGAACTACAGTTCCTGAGGAAGAACTAAATCCAAAGATACTAGCTTTGCAGAATGCT
                    ************************************************************

HsCD00004832        CAGAGAAAGCGAAAAATGGAACATGATGGTTCACTTTTTCAAGCAGTAGGAATTGGAACA
NM_001243084.1      CAGAGAAAGCGAAAAATGGAACATGATGGTTCACTTTTTCAAGCAGTAGGAATTGGAACA
NM_001530.3         CAGAGAAAGCGAAAAATGGAACATGATGGTTCACTTTTTCAAGCAGTAGGAATTGGAACA
                    ************************************************************

HsCD00004832        TTATTACAGCAGCCAGACGATCATGCAGCTACTACATCACTTTCTTGGAAACGTGTAAAA
NM_001243084.1      TTATTACAGCAGCCAGACGATCATGCAGCTACTACATCACTTTCTTGGAAACGTGTAAAA
NM_001530.3         TTATTACAGCAGCCAGACGATCATGCAGCTACTACATCACTTTCTTGGAAACGTGTAAAA
                    ************************************************************

HsCD00004832        GGATGCAAATCTAGTGAACAGAATGGAATGGAGCAAAAGACAATTATTTTAATACCCTCT
NM_001243084.1      GGATGCAAATCTAGTGAACAGAATGGAATGGAGCAAAAGACAATTATTTTAATACCCTCT
NM_001530.3         GGATGCAAATCTAGTGAACAGAATGGAATGGAGCAAAAGACAATTATTTTAATACCCTCT
                    ************************************************************

HsCD00004832        GATTTAGCATGTAGACTGCTGGGGCAATCAATGGATGAAAGTGGATTACCACAGCTGACC
NM_001243084.1      GATTTAGCATGTAGACTGCTGGGGCAATCAATGGATGAAAGTGGATTACCACAGCTGACC
NM_001530.3         GATTTAGCATGTAGACTGCTGGGGCAATCAATGGATGAAAGTGGATTACCACAGCTGACC
                    ************************************************************

HsCD00004832        AGTTATGATTGTGAAGTTAATGCTCCTATACAAGGCAGCAGAAACCTACTGCAGGGTGAA
NM_001243084.1      AGTTATGATTGTGAAGTTAATGCTCCTATACAAGGCAGCAGAAACCTACTGCAGGGTGAA
NM_001530.3         AGTTATGATTGTGAAGTTAATGCTCCTATACAAGGCAGCAGAAACCTACTGCAGGGTGAA
                    ************************************************************

HsCD00004832        GAATTACTCAGAGCTTTGGATCAAGTTAACTAG
NM_001243084.1      GAATTACTCAGAGCTTTGGATCAAGTTAACTGA
NM_001530.3         GAATTACTCAGAGCTTTGGATCAAGTTAACTGA
                    *******************************..

Pathways

NCI : AP-1 transcription factor network
NCI : HIF-1-alpha transcription factor network
NCI : Hypoxic and oxygen homeostasis regulation of HIF-1-alpha
NCI : Notch-mediated HES/HEY network
NCI : VEGFR1 specific signals
Panther : Angiogenesis
Panther : Hypoxia response via HIF activation
Panther : VEGF signaling pathway
Reactome : Cellular response to hypoxia
Reactome : Cellular responses to stress
Reactome : Circadian Clock
Reactome : Disease
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : NOTCH1 Intracellular Domain Regulates Transcription
Reactome : Oxygen-dependent asparagine hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Oxygen-dependent proline hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Regulation of Hypoxia-inducible Factor (HIF) by oxygen
Reactome : Regulation of gene expression by Hypoxia-inducible Factor
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
WikiPathway : Adipogenesis
WikiPathway : Angiogenesis
WikiPathway : Notch Signaling Pathway

Clone

Cloning Information : 24883
HIP Master Clone ID : 55259
Original Clone ID : FLH024883.01X

Organism


TAX_ID : 9606
Species Specific ID: 3091

Genome

Chromosome : 14
Map Location : 14q23.2
Ensembl : ENSG00000100644

Reagents

Labome : HIF-1-alpha-antibody