DNASU Plasmid Repository • 480.965.5697 | Email

CD44 (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  CD44
Gene Name:  CD44 molecule (Indian blood group)
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH127885.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Discrepancy :
No / Yes
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1086nts         Open reading frame : 1 to 1086
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1114
Start on reference sequence 29
t255c; a326c,Y109S

5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : CD44
Symbol Nomenclature : CD44
Designation : CD44 antigen|GP90 lymphocyte homing/adhesion receptor|Hermes antigen|cell surface glycoprotein CD44|chondroitin sulfate proteoglycan 8|epican|extracellular matrix receptor III|hematopoietic cell E- and L-selectin ligand|heparan sulfate proteoglycan|homing function and Indian blood group system|hyaluronate receptor|phagocytic glycoprotein 1
Full Nomenclature : CD44 molecule (Indian blood group)
GENEID : 960
Locus Tag : AL133330.1
GI : 60830198
GenBank Accession : AY893879
HGNC : 1681
MIM : 107269
Vega : OTTHUMG00000044388
Target GenBank: M59040


Reference Sequence Alignment













HsCD00004894        GCTACCAG----------------------------------------------------
NM_001202555.1      GCTACCAATAG-------------------------------------------------
NM_001001390.1      GC---TAC---CAATATGGACTCCAG----------------------------------
NM_001001389.1      GC---TAC---CAGTACG------------------------------------------
NM_001202556.1      ------------GCTAC-CAGA--------------------------------------
NM_001001391.1      ------------GCTAC-CAGAGA------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001001390.1      ------------------------------------------------------------
NM_001001389.1      ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001001390.1      ------------------------------------------------------------
NM_001001389.1      ----------------------------------TCTTCAAATACCATCTCAGCAGGCTG
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001001390.1      ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001001390.1      ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001001390.1      ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001001390.1      ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001001390.1      ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001001390.1      ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001001390.1      ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001001390.1      ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001001390.1      ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001001390.1      ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202555.1      ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------------------------------------------
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ------------------------------------------------------------

HsCD00004894        ------------------------AGACCAAGACACATTCCACCCCAGTGGGGGGTCCCA
NM_001202556.1      ------------------------------------------------------------
NM_001001391.1      ---------------------------CCAAGACACATTCCACCCCAGTGGGGGGTCCCA

NM_001202556.1      ----------------------------CACTCACATGGGAGTCAAGAAGGTGGAGCAAA






                    ******************* *.


NCI : Osteopontin-mediated events
NCI : a4b7 Integrin signaling
Panther : Alzheimer disease-presenilin pathway
Reactome : Cell surface interactions at the vascular wall
Reactome : Cytokine Signaling in Immune system
Reactome : Degradation of the extracellular matrix
Reactome : Disease
Reactome : Extracellular matrix organization
Reactome : Gene Expression
Reactome : Glycogen storage diseases
Reactome : Glycosaminoglycan metabolism
Reactome : Hemostasis
Reactome : Hyaluronan metabolism
Reactome : Hyaluronan uptake and degradation
Reactome : Immune System
Reactome : Insulin-like Growth Factor-2 mRNA Binding Proteins (IGF2BPs/IMPs/VICKZs) bind RNA
Reactome : Integrin cell surface interactions
Reactome : Interferon Signaling
Reactome : Interferon gamma signaling
Reactome : MPS I - Hurler syndrome
Reactome : MPS II - Hunter syndrome
Reactome : MPS IIIA - Sanfilippo syndrome A
Reactome : MPS IIIB - Sanfilippo syndrome B
Reactome : MPS IIIC - Sanfilippo syndrome C
Reactome : MPS IIID - Sanfilippo syndrome D
Reactome : MPS IV - Morquio syndrome A
Reactome : MPS IV - Morquio syndrome B
Reactome : MPS IX - Natowicz syndrome
Reactome : MPS VI - Maroteaux-Lamy syndrome
Reactome : MPS VII - Sly syndrome
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Mucopolysaccharidoses
Reactome : Myoclonic epilepsy of Lafora
WikiPathway : Senescence and Autophagy
WikiPathway : Wnt Signaling Pathway and Pluripotency


SMART domain : LINK : Link (Hyaluronan-binding)
UniProt : B6EAT9
UniProt : P16070
UniProt : O95370
HPRD : 00115


Cloning Information : 127885
HIP Master Clone ID : 104034
Original Clone ID : FLH127885.01L


TAX_ID : 9606
Species Specific ID: 960


Chromosome : 11
Map Location : 11p13
Ensembl : ENSG00000026508


Labome : CD44-antibody