DNASU Plasmid Repository • 480.965.5697 | Email

PLAUR (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PLAUR
Gene Name:  plasminogen activator, urokinase receptor
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH018927.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00004905

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1008nts         Open reading frame : 1 to 1008
Reference Sequence Alignment

ATGGGTCACCCGCCGCTGCTGCCGCTGCTGCTGCTGCTCCACACTTGCGTCCCAGCCTCT
TGGGGCCTGCGGTGCATGCAGTGTAAGACCAACGGGGATTGCCGTGTGGAAGAGTGCGCC
CTGGGACAGGACCTCTGCAGGACCACGATCGTGCGCTTGTGGGAAGAAGGAGAAGAGCTG
GAGCTGGTGGAGAAAAGCTGTACCCACTCAGAGAAGACCAACAGGACCCTGAGCTATCGG
ACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCAACCAG
GGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTTCCTGT
GGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCAGCCCT
GAAGAACAGTGCCTGGATGTGGTGACCCACTGGATCCAGGAAGGTGAAGAAGGGCGTCCA
AAGGATGACCGCCACCTCCGTGGCTGTGGCTACCTTCCCGGCTGCCCGGGCTCCAATGGT
TTCCACAACAACGACACCTTCCACTTCCTGAAATGCTGCAACACCACCAAATGCAACGAG
GGCCCAATCCTGGAGCTTGAAAATCTGCCGCAGAATGGCCGCCAGTGTTACAGCTGCAAG
GGGAACAGCACCCATGGATGCTCCTCTGAAGAGACTTTCCTCATTGACTGCCGAGGCCCC
ATGAATCAATGTCTGGTAGCCACCGGCACTCACGAACCGAAAAACCAAAGCTATATGGTA
AGAGGCTGTGCAACCGCCTCAATGTGCCAACATGCCCACCTGGGTGACGCCTTCAGCATG
AACCACATTGATGTCTCCTGCTGTACTAAAAGTGGCTGTAACCACCCAGACCTGGATGTC
CAGTACCGCAGTGGGGCTGCTCCTCAGCCTGGCCCTGCCCATCTCAGCCCCACCATCACC
CTGCTAATGACTGCCAGACTGTGGGGAGGCACTCTCCTCTGGACCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1054
Start on reference sequence 47
Mutations:
None
Discrepancy:
c45t; t950c,L317P
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PLAUR
Symbol Nomenclature : PLAUR
SYNONYM : CD87; U-PAR; UPAR; URKR
Designation : monocyte activation antigen Mo3|u-plasminogen activator receptor form 2|urokinase plasminogen activator surface receptor|urokinase-type plasminogen activator (uPA) receptor
Full Nomenclature : plasminogen activator, urokinase receptor
GENEID : 5329
GI : 61363007
GenBank Accession : AY890376
HGNC : 9053
MIM : 173391
Vega : OTTHUMG00000182778
Target GenBank: X51675

 

Reference Sequence Alignment

  

HsCD00004905      ATGGGTCACCCGCCGCTGCTGCCGCTGCTGCTGCTGCTCCACACTTGCGTCCCAGCCTCT
NM_002659.3       ATGGGTCACCCGCCGCTGCTGCCGCTGCTGCTGCTGCTCCACACCTGCGTCCCAGCCTCT
                  ******************************************** ***************

HsCD00004905      TGGGGCCTGCGGTGCATGCAGTGTAAGACCAACGGGGATTGCCGTGTGGAAGAGTGCGCC
NM_002659.3       TGGGGCCTGCGGTGCATGCAGTGTAAGACCAACGGGGATTGCCGTGTGGAAGAGTGCGCC
                  ************************************************************

HsCD00004905      CTGGGACAGGACCTCTGCAGGACCACGATCGTGCGCTTGTGGGAAGAAGGAGAAGAGCTG
NM_002659.3       CTGGGACAGGACCTCTGCAGGACCACGATCGTGCGCTTGTGGGAAGAAGGAGAAGAGCTG
                  ************************************************************

HsCD00004905      GAGCTGGTGGAGAAAAGCTGTACCCACTCAGAGAAGACCAACAGGACCCTGAGCTATCGG
NM_002659.3       GAGCTGGTGGAGAAAAGCTGTACCCACTCAGAGAAGACCAACAGGACCCTGAGCTATCGG
                  ************************************************************

HsCD00004905      ACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCAACCAG
NM_002659.3       ACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCAACCAG
                  ************************************************************

HsCD00004905      GGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTTCCTGT
NM_002659.3       GGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTTCCTGT
                  ************************************************************

HsCD00004905      GGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCAGCCCT
NM_002659.3       GGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCAGCCCT
                  ************************************************************

HsCD00004905      GAAGAACAGTGCCTGGATGTGGTGACCCACTGGATCCAGGAAGGTGAAGAAGGGCGTCCA
NM_002659.3       GAAGAACAGTGCCTGGATGTGGTGACCCACTGGATCCAGGAAGGTGAAGAAGGGCGTCCA
                  ************************************************************

HsCD00004905      AAGGATGACCGCCACCTCCGTGGCTGTGGCTACCTTCCCGGCTGCCCGGGCTCCAATGGT
NM_002659.3       AAGGATGACCGCCACCTCCGTGGCTGTGGCTACCTTCCCGGCTGCCCGGGCTCCAATGGT
                  ************************************************************

HsCD00004905      TTCCACAACAACGACACCTTCCACTTCCTGAAATGCTGCAACACCACCAAATGCAACGAG
NM_002659.3       TTCCACAACAACGACACCTTCCACTTCCTGAAATGCTGCAACACCACCAAATGCAACGAG
                  ************************************************************

HsCD00004905      GGCCCAATCCTGGAGCTTGAAAATCTGCCGCAGAATGGCCGCCAGTGTTACAGCTGCAAG
NM_002659.3       GGCCCAATCCTGGAGCTTGAAAATCTGCCGCAGAATGGCCGCCAGTGTTACAGCTGCAAG
                  ************************************************************

HsCD00004905      GGGAACAGCACCCATGGATGCTCCTCTGAAGAGACTTTCCTCATTGACTGCCGAGGCCCC
NM_002659.3       GGGAACAGCACCCATGGATGCTCCTCTGAAGAGACTTTCCTCATTGACTGCCGAGGCCCC
                  ************************************************************

HsCD00004905      ATGAATCAATGTCTGGTAGCCACCGGCACTCACGAACCGAAAAACCAAAGCTATATGGTA
NM_002659.3       ATGAATCAATGTCTGGTAGCCACCGGCACTCACGAACCGAAAAACCAAAGCTATATGGTA
                  ************************************************************

HsCD00004905      AGAGGCTGTGCAACCGCCTCAATGTGCCAACATGCCCACCTGGGTGACGCCTTCAGCATG
NM_002659.3       AGAGGCTGTGCAACCGCCTCAATGTGCCAACATGCCCACCTGGGTGACGCCTTCAGCATG
                  ************************************************************

HsCD00004905      AACCACATTGATGTCTCCTGCTGTACTAAAAGTGGCTGTAACCACCCAGACCTGGATGTC
NM_002659.3       AACCACATTGATGTCTCCTGCTGTACTAAAAGTGGCTGTAACCACCCAGACCTGGATGTC
                  ************************************************************

HsCD00004905      CAGTACCGCAGTGGGGCTGCTCCTCAGCCTGGCCCTGCCCATCTCAGCCCCACCATCACC
NM_002659.3       CAGTACCGCAGTGGGGCTGCTCCTCAGCCTGGCCCTGCCCATCTCAGCCTCACCATCACC
                  ************************************************* **********

HsCD00004905      CTGCTAATGACTGCCAGACTGTGGGGAGGCACTCTCCTCTGGACCTAG
NM_002659.3       CTGCTAATGACTGCCAGACTGTGGGGAGGCACTCTCCTCTGGACCTAA
                  ***********************************************.

Pathways

NCI : Arf6 downstream pathway
NCI : Beta1 integrin cell surface interactions
NCI : Beta2 integrin cell surface interactions
NCI : Beta3 integrin cell surface interactions
NCI : Beta5 beta6 beta7 and beta8 integrin cell surface interactions
NCI : FGF signaling pathway
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : Validated transcriptional targets of AP1 family members Fra1 and Fra2
NCI : amb2 Integrin signaling
Panther : Blood coagulation
Panther : Plasminogen activating cascade
Reactome : Attachment of GPI anchor to uPAR
Reactome : Dissolution of Fibrin Clot
Reactome : Hemostasis
Reactome : Metabolism of proteins
Reactome : Post-translational modification: synthesis of GPI-anchored proteins
Reactome : Post-translational protein modification
WikiPathway : Complement and Coagulation Cascades

Protein

SMART domain : LU : Ly-6 antigen / uPA receptor -like domain
UniProt : Q03405
HPRD : 01421

Clone

Cloning Information : 18927
HIP Master Clone ID : 33126
Original Clone ID : FLH018927.01X

Organism


TAX_ID : 9606
Species Specific ID: 5329

Genome

Chromosome : 19
Map Location : 19q13
Ensembl : ENSG00000011422

Reagents

Labome : uPAR-antibody