DNASU Plasmid Repository • 480.965.5697 | Email

PLAUR (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PLAUR
Gene Name:  plasminogen activator, urokinase receptor
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH127783.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00004906

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1008nts         Open reading frame : 1 to 1008
Reference Sequence Alignment

ATGGGTCACCCGCCGCTGCTGCCGCTGCTGCTGCTGCTCCACACCTGCGTCCCAGCCTCT
TGGGGCCTGCGGTGCATGCAGTGTAAGACCAACGGGGATTGCCGTGTGGAAGAGTGCGCC
CTGGGACAGGACCTCTGCAGGACCACGATCGTGCGCTTGTGGGAAGAAGGAGAAGAGCTG
GAGCTGGTGGAGAAAAGCTGTACCCACTCAGAGAAGACCAACAGGACCCTGAGCTATCGG
ACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCAACCAG
GGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTTCCTGT
GGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCAGCCCT
GAAGAACAGTGCCTGGATGTGGTGACCCACTGGATCCAGGAAGGTGAAGAAGGGCGTCCA
AAGGATGACCGCCACCTCCGTGGCTGTGGCTACCTTCCCGGCTGCCCGGGCTCCAATGGT
TTCCACAACAACGACACCTTCCACTTCCTGAAATGCTGCAACACCACCAAATGCAACGAG
GGCCCAATCCTGGAGCTTGAAAATCTGCCGCAGAATGGCCGCCAGTGTTACAGCTGCAAG
GGGAACAGCACCCATGGATGCTCCTCTGAAGAGACTTTCCTCATTGACTGCCGAGGCCCC
ATGAATCAATGTCTGGTAGCCACCGGCACTCACGAACCGAAAAACCAAAGCTATATGGTA
AGAGGCTGTGCAACCGCCTCAATGTGCCAACATGCCCACCTGGGTGACGCCTTCAGCATG
AACCACATTGATGTCTCCTGCTGTACTAAAAGTGGCTGTAACCACCCAGACCTGGATGTC
CAGTACCGCAGTGGGGCTGCTCCTCAGCCTGGCCCTGCCCATCTCAGCCTCACCATCACC
CTGCTAATGACTGCCAGACTGTGGGGAGGCACTCTCCTCTGGACCTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1054
Start on reference sequence 47
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PLAUR
Symbol Nomenclature : PLAUR
SYNONYM : CD87; U-PAR; UPAR; URKR
Designation : monocyte activation antigen Mo3|u-plasminogen activator receptor form 2|urokinase plasminogen activator surface receptor|urokinase-type plasminogen activator (uPA) receptor
Full Nomenclature : plasminogen activator, urokinase receptor
GENEID : 5329
GI : 60818642
GenBank Accession : AY893435
HGNC : 9053
MIM : 173391
Vega : OTTHUMG00000182778
Target GenBank: X51675

 

Reference Sequence Alignment

  

HsCD00004906      ATGGGTCACCCGCCGCTGCTGCCGCTGCTGCTGCTGCTCCACACCTGCGTCCCAGCCTCT
NM_002659.3       ATGGGTCACCCGCCGCTGCTGCCGCTGCTGCTGCTGCTCCACACCTGCGTCCCAGCCTCT
                  ************************************************************

HsCD00004906      TGGGGCCTGCGGTGCATGCAGTGTAAGACCAACGGGGATTGCCGTGTGGAAGAGTGCGCC
NM_002659.3       TGGGGCCTGCGGTGCATGCAGTGTAAGACCAACGGGGATTGCCGTGTGGAAGAGTGCGCC
                  ************************************************************

HsCD00004906      CTGGGACAGGACCTCTGCAGGACCACGATCGTGCGCTTGTGGGAAGAAGGAGAAGAGCTG
NM_002659.3       CTGGGACAGGACCTCTGCAGGACCACGATCGTGCGCTTGTGGGAAGAAGGAGAAGAGCTG
                  ************************************************************

HsCD00004906      GAGCTGGTGGAGAAAAGCTGTACCCACTCAGAGAAGACCAACAGGACCCTGAGCTATCGG
NM_002659.3       GAGCTGGTGGAGAAAAGCTGTACCCACTCAGAGAAGACCAACAGGACCCTGAGCTATCGG
                  ************************************************************

HsCD00004906      ACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCAACCAG
NM_002659.3       ACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCAACCAG
                  ************************************************************

HsCD00004906      GGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTTCCTGT
NM_002659.3       GGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTTCCTGT
                  ************************************************************

HsCD00004906      GGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCAGCCCT
NM_002659.3       GGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCAGCCCT
                  ************************************************************

HsCD00004906      GAAGAACAGTGCCTGGATGTGGTGACCCACTGGATCCAGGAAGGTGAAGAAGGGCGTCCA
NM_002659.3       GAAGAACAGTGCCTGGATGTGGTGACCCACTGGATCCAGGAAGGTGAAGAAGGGCGTCCA
                  ************************************************************

HsCD00004906      AAGGATGACCGCCACCTCCGTGGCTGTGGCTACCTTCCCGGCTGCCCGGGCTCCAATGGT
NM_002659.3       AAGGATGACCGCCACCTCCGTGGCTGTGGCTACCTTCCCGGCTGCCCGGGCTCCAATGGT
                  ************************************************************

HsCD00004906      TTCCACAACAACGACACCTTCCACTTCCTGAAATGCTGCAACACCACCAAATGCAACGAG
NM_002659.3       TTCCACAACAACGACACCTTCCACTTCCTGAAATGCTGCAACACCACCAAATGCAACGAG
                  ************************************************************

HsCD00004906      GGCCCAATCCTGGAGCTTGAAAATCTGCCGCAGAATGGCCGCCAGTGTTACAGCTGCAAG
NM_002659.3       GGCCCAATCCTGGAGCTTGAAAATCTGCCGCAGAATGGCCGCCAGTGTTACAGCTGCAAG
                  ************************************************************

HsCD00004906      GGGAACAGCACCCATGGATGCTCCTCTGAAGAGACTTTCCTCATTGACTGCCGAGGCCCC
NM_002659.3       GGGAACAGCACCCATGGATGCTCCTCTGAAGAGACTTTCCTCATTGACTGCCGAGGCCCC
                  ************************************************************

HsCD00004906      ATGAATCAATGTCTGGTAGCCACCGGCACTCACGAACCGAAAAACCAAAGCTATATGGTA
NM_002659.3       ATGAATCAATGTCTGGTAGCCACCGGCACTCACGAACCGAAAAACCAAAGCTATATGGTA
                  ************************************************************

HsCD00004906      AGAGGCTGTGCAACCGCCTCAATGTGCCAACATGCCCACCTGGGTGACGCCTTCAGCATG
NM_002659.3       AGAGGCTGTGCAACCGCCTCAATGTGCCAACATGCCCACCTGGGTGACGCCTTCAGCATG
                  ************************************************************

HsCD00004906      AACCACATTGATGTCTCCTGCTGTACTAAAAGTGGCTGTAACCACCCAGACCTGGATGTC
NM_002659.3       AACCACATTGATGTCTCCTGCTGTACTAAAAGTGGCTGTAACCACCCAGACCTGGATGTC
                  ************************************************************

HsCD00004906      CAGTACCGCAGTGGGGCTGCTCCTCAGCCTGGCCCTGCCCATCTCAGCCTCACCATCACC
NM_002659.3       CAGTACCGCAGTGGGGCTGCTCCTCAGCCTGGCCCTGCCCATCTCAGCCTCACCATCACC
                  ************************************************************

HsCD00004906      CTGCTAATGACTGCCAGACTGTGGGGAGGCACTCTCCTCTGGACCTAA
NM_002659.3       CTGCTAATGACTGCCAGACTGTGGGGAGGCACTCTCCTCTGGACCTAA
                  ************************************************

Pathways

NCI : Arf6 downstream pathway
NCI : Beta1 integrin cell surface interactions
NCI : Beta2 integrin cell surface interactions
NCI : Beta3 integrin cell surface interactions
NCI : Beta5 beta6 beta7 and beta8 integrin cell surface interactions
NCI : FGF signaling pathway
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : Validated transcriptional targets of AP1 family members Fra1 and Fra2
NCI : amb2 Integrin signaling
Panther : Blood coagulation
Panther : Plasminogen activating cascade
Reactome : Attachment of GPI anchor to uPAR
Reactome : Dissolution of Fibrin Clot
Reactome : Hemostasis
Reactome : Metabolism of proteins
Reactome : Post-translational modification: synthesis of GPI-anchored proteins
Reactome : Post-translational protein modification
WikiPathway : Complement and Coagulation Cascades

Protein

SMART domain : LU : Ly-6 antigen / uPA receptor -like domain
UniProt : Q03405
HPRD : 01421

Clone

Cloning Information : 127783
HIP Master Clone ID : 103932
Original Clone ID : FLH127783.01X

Organism


TAX_ID : 9606
Species Specific ID: 5329

Genome

Chromosome : 19
Map Location : 19q13
Ensembl : ENSG00000011422

Reagents

Labome : uPAR-antibody