DNASU Plasmid Repository • 480.965.5697 | Email

TNFSF6 (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  FASLG
Gene Name:  Fas ligand (TNF superfamily, member 6)
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH127914.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 846nts         Open reading frame : 1 to 846
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1034
Start on reference sequence 189
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : FASLG
Symbol Nomenclature : FASLG
Designation : CD95 ligand|apoptosis (APO-1) antigen ligand 1|apoptosis antigen ligand|fas antigen ligand|tumor necrosis factor (ligand) superfamily, member 6|tumor necrosis factor ligand superfamily member 6
Full Nomenclature : Fas ligand (TNF superfamily, member 6)
GENEID : 356
GI : 60830320
GenBank Accession : AY893886
HGNC : 11936
MIM : 134638
Vega : OTTHUMG00000034841
Target GenBank: D38122


Reference Sequence Alignment
















HsCD00004917      CTCTTG
NM_000639.1       CTCTAA


NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Calcium signaling in the CD4+ TCR pathway
NCI : Caspase Cascade in Apoptosis
NCI : Downstream signaling in naïve CD8+ T cells
NCI : FAS (CD95) signaling pathway
NCI : FoxO family signaling
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : IL12-mediated signaling events
NCI : IL2 signaling events mediated by STAT5
Panther : Apoptosis signaling pathway
Panther : FAS signaling pathway
Reactome : Apoptosis
Reactome : Caspase-8 activation
Reactome : Death Receptor Signalling
Reactome : Dimerization of procaspase-8
Reactome : Extrinsic Pathway for Apoptosis
Reactome : FasL/ CD95L signaling
Reactome : Regulation by c-FLIP
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : MAPK signaling pathway


SMART domain : TNF : Tumour necrosis factor family.
UniProt : P48023
UniProt : Q53ZZ1
HPRD : 00610


Cloning Information : 127914
HIP Master Clone ID : 104063
Original Clone ID : FLH127914.01L


TAX_ID : 9606
Species Specific ID: 356


Chromosome : 1
Map Location : 1q23
Ensembl : ENSG00000117560


Labome : FasL-antibody