DNASU Plasmid Repository • 480.965.5697 | Email

CCND1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CCND1
Gene Name:  cyclin D1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH127861.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00004949

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 888nts         Open reading frame : 1 to 888
Reference Sequence Alignment

ATGGAACACCAGCTCCTGTGCTGCGAAGTGGAAACCATCCGCCGCGCGTACCCCGATGCC
AACCTCCTCAACGACCGGGTGCTGCGGGCCATGCTGAAGGCGGAGGAGACCTGCGCGCCC
TCGGTGTCCTACTTCAAATGTGTGCAGAAGGAGGCCCTGCCGTCCATGCGGAAGATCGTC
GCCACCTGGATGCTGGAGGTCTGCGAGGAACAGAAGTGCGAGGAGGAGGTCTTCCCGCTG
GCCATGAACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAG
CTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACG
GCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATG
GAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTC
ATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAA
CACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCC
TCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCC
AACAACTTCCTGTCCTACTACCGCCTCACACGCTTCCTCTCCAGAGTGATCAAGTGTGAC
CCAGACTGCCTCCGGGCCTGCCAGGAGCAGATCGAAGCCCTGCTGGAGTCAAGCCTGCGC
CAGGCCCAGCAGAACATGGACCCCAAGGCCGCCGAGGAGGAGGAAGAGGAGGAGGAGGAG
GTGGACCTGGCTTGCACACCCACCGACGTGCGGGACGTGGACATCGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1035
Start on reference sequence 148
Mutations:
None
Discrepancy:
t155c,V52A
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CCND1
Symbol Nomenclature : CCND1
SYNONYM : BCL1; D11S287E; PRAD1; U21B31
Designation : B-cell CLL/lymphoma 1|B-cell lymphoma 1 protein|BCL-1 oncogene|G1/S-specific cyclin-D1|PRAD1 oncogene
Full Nomenclature : cyclin D1
GENEID : 595
GI : 60830512
GenBank Accession : AY893895
HGNC : 1582
MIM : 168461
Vega : OTTHUMG00000167877
Target GenBank: X59798

 

Reference Sequence Alignment

  

HsCD00004949      ATGGAACACCAGCTCCTGTGCTGCGAAGTGGAAACCATCCGCCGCGCGTACCCCGATGCC
NM_053056.2       ATGGAACACCAGCTCCTGTGCTGCGAAGTGGAAACCATCCGCCGCGCGTACCCCGATGCC
                  ************************************************************

HsCD00004949      AACCTCCTCAACGACCGGGTGCTGCGGGCCATGCTGAAGGCGGAGGAGACCTGCGCGCCC
NM_053056.2       AACCTCCTCAACGACCGGGTGCTGCGGGCCATGCTGAAGGCGGAGGAGACCTGCGCGCCC
                  ************************************************************

HsCD00004949      TCGGTGTCCTACTTCAAATGTGTGCAGAAGGAGGCCCTGCCGTCCATGCGGAAGATCGTC
NM_053056.2       TCGGTGTCCTACTTCAAATGTGTGCAGAAGGAGGTCCTGCCGTCCATGCGGAAGATCGTC
                  ********************************** *************************

HsCD00004949      GCCACCTGGATGCTGGAGGTCTGCGAGGAACAGAAGTGCGAGGAGGAGGTCTTCCCGCTG
NM_053056.2       GCCACCTGGATGCTGGAGGTCTGCGAGGAACAGAAGTGCGAGGAGGAGGTCTTCCCGCTG
                  ************************************************************

HsCD00004949      GCCATGAACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAG
NM_053056.2       GCCATGAACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAG
                  ************************************************************

HsCD00004949      CTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACG
NM_053056.2       CTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACG
                  ************************************************************

HsCD00004949      GCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATG
NM_053056.2       GCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATG
                  ************************************************************

HsCD00004949      GAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTC
NM_053056.2       GAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTC
                  ************************************************************

HsCD00004949      ATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAA
NM_053056.2       ATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAA
                  ************************************************************

HsCD00004949      CACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCC
NM_053056.2       CACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCC
                  ************************************************************

HsCD00004949      TCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCC
NM_053056.2       TCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCC
                  ************************************************************

HsCD00004949      AACAACTTCCTGTCCTACTACCGCCTCACACGCTTCCTCTCCAGAGTGATCAAGTGTGAC
NM_053056.2       AACAACTTCCTGTCCTACTACCGCCTCACACGCTTCCTCTCCAGAGTGATCAAGTGTGAC
                  ************************************************************

HsCD00004949      CCAGACTGCCTCCGGGCCTGCCAGGAGCAGATCGAAGCCCTGCTGGAGTCAAGCCTGCGC
NM_053056.2       CCGGACTGCCTCCGGGCCTGCCAGGAGCAGATCGAAGCCCTGCTGGAGTCAAGCCTGCGC
                  **.*********************************************************

HsCD00004949      CAGGCCCAGCAGAACATGGACCCCAAGGCCGCCGAGGAGGAGGAAGAGGAGGAGGAGGAG
NM_053056.2       CAGGCCCAGCAGAACATGGACCCCAAGGCCGCCGAGGAGGAGGAAGAGGAGGAGGAGGAG
                  ************************************************************

HsCD00004949      GTGGACCTGGCTTGCACACCCACCGACGTGCGGGACGTGGACATCGAC
NM_053056.2       GTGGACCTGGCTTGCACACCCACCGACGTGCGGGACGTGGACATCTGA
                  ********************************************* ..

Pathways

NCI : AP-1 transcription factor network
NCI : ATF-2 transcription factor network
NCI : C-MYB transcription factor network
NCI : Coregulation of Androgen receptor activity
NCI : E-cadherin signaling in the nascent adherens junction
NCI : FOXM1 transcription factor network
NCI : Integrin-linked kinase signaling
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Notch signaling pathway
NCI : Presenilin action in Notch and Wnt signaling
NCI : Regulation of Telomerase
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Regulation of retinoblastoma protein
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling mediated by p38-gamma and p38-delta
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : Validated nuclear estrogen receptor alpha network
NCI : Validated targets of C-MYC transcriptional repression
NCI : Validated transcriptional targets of AP1 family members Fra1 and Fra2
Panther : PI3 kinase pathway
Panther : Wnt signaling pathway
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cyclin D associated events in G1
Reactome : G1 Phase
Reactome : Mitotic G1-G1/S phases
Reactome : Pre-NOTCH Expression and Processing
Reactome : Pre-NOTCH Transcription and Translation
Reactome : S Phase
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Ubiquitin-dependent degradation of Cyclin D
Reactome : Ubiquitin-dependent degradation of Cyclin D1
WikiPathway : Androgen receptor signaling pathway
WikiPathway : DNA damage response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Epithelium TarBase
WikiPathway : ErbB signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : G1 to S cell cycle control
WikiPathway : IL-7 signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Leptin signaling pathway
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Notch Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

SMART domain : CYCLIN : domain present in cyclins, TFIIB and Retinoblastoma
UniProt : P24385
UniProt : Q6FI00
HPRD : 01346

Clone

Cloning Information : 127861
HIP Master Clone ID : 104010
Original Clone ID : FLH127861.01L

Organism


TAX_ID : 9606
Species Specific ID: 595

Genome

Chromosome : 11
Map Location : 11q13
Ensembl : ENSG00000110092

Reagents

Labome : cyclin-D1-antibody