DNASU Plasmid Repository • 480.965.5697 | Email

AKT1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  AKT1
Gene Name:  v-akt murine thymoma viral oncogene homolog 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH127841.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1443nts         Open reading frame : 1 to 1443
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1641
Start on reference sequence 199

5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : AKT1
Symbol Nomenclature : AKT1
Designation : PKB alpha|RAC-PK-alpha|RAC-alpha serine/threonine-protein kinase|protein kinase B alpha|proto-oncogene c-Akt|rac protein kinase alpha
Full Nomenclature : v-akt murine thymoma viral oncogene homolog 1
GENEID : 207
GI : 60819919
GenBank Accession : AY893480
HGNC : 391
MIM : 164730
Vega : OTTHUMG00000170795
Target GenBank: M63167


Reference Sequence Alignment


























HsCD00005047        TGA
NM_001014432.1      TGA
NM_001014431.1      TGA
XM_005267401.1      TGA
NM_005163.2         TGA


NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Aurora A signaling
NCI : BCR signaling pathway
NCI : CD40/CD40L signaling
NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : Caspase Cascade in Apoptosis
NCI : Ceramide signaling pathway
NCI : Class I PI3K signaling events mediated by Akt
NCI : Coregulation of Androgen receptor activity
NCI : E-cadherin signaling in keratinocytes
NCI : E-cadherin signaling in the nascent adherens junction
NCI : Endothelins
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : FAS (CD95) signaling pathway
NCI : FGF signaling pathway
NCI : FOXA2 and FOXA3 transcription factor networks
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : FoxO family signaling
NCI : Glucocorticoid receptor regulatory network
NCI : HIF-1-alpha transcription factor network
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : IFN-gamma pathway
NCI : IGF1 pathway
NCI : IL2 signaling events mediated by PI3K
NCI : IL4-mediated signaling events
NCI : IL6-mediated signaling events
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : Insulin Pathway
NCI : Insulin-mediated glucose transport
NCI : Integrin-linked kinase signaling
NCI : Integrins in angiogenesis
NCI : LPA receptor mediated events
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Nongenotropic Androgen signaling
NCI : Plasma membrane estrogen receptor signaling
NCI : Reelin signaling pathway
NCI : Regulation of Telomerase
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Retinoic acid receptors-mediated signaling
NCI : S1P3 pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events mediated by the Hedgehog family
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : Thromboxane A2 receptor signaling
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : VEGFR1 specific signals
NCI : VEGFR3 signaling in lymphatic endothelium
NCI : a6b1 and a6b4 Integrin signaling
NCI : amb2 Integrin signaling
NCI : mTOR signaling pathway
NCI : p53 pathway
NCI : p75(NTR)-mediated signaling
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Huntington disease
Panther : Hypoxia response via HIF activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Interleukin signaling pathway
Panther : PI3 kinase pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway by glucose deprivation
Panther : p53 pathway feedback loops 2
Reactome : AKT phosphorylates targets in the cytosol
Reactome : AKT phosphorylates targets in the nucleus
Reactome : AKT-mediated inactivation of FOXO1A
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Adaptive Immune System
Reactome : Apoptosis
Reactome : Butyrate Response Factor 1 (BRF1) destabilizes mRNA
Reactome : CD28 co-stimulation
Reactome : CD28 dependent PI3K/Akt signaling
Reactome : CTLA4 inhibitory signaling
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Costimulation by the CD28 family
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downregulation of ERBB2:ERBB3 signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : G beta:gamma signalling through PI3Kgamma
Reactome : G-protein beta:gamma signalling
Reactome : GAB1 signalosome
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : Gene Expression
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Integrin alphaIIb beta3 signaling
Reactome : Intrinsic Pathway for Apoptosis
Reactome : KSRP destabilizes mRNA
Reactome : Membrane Trafficking
Reactome : Metabolism
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : Metabolism of nitric oxide
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of the PI3K/AKT network
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of beta-cell development
Reactome : Regulation of gene expression in beta cells
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Wnt
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : TCF dependent signaling in response to WNT
Reactome : Tetrahydrobiopterin (BH4) synthesis, recycling, salvage and regulation
Reactome : Translocation of GLUT4 to the plasma membrane
Reactome : deactivation of the beta-catenin transactivating complex
Reactome : eNOS activation
Reactome : eNOS activation and regulation
WikiPathway : AMPK signaling
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : Androgen receptor signaling pathway
WikiPathway : Angiogenesis
WikiPathway : Apoptosis
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : EPO Receptor Signaling
WikiPathway : Endochondral Ossification
WikiPathway : Estrogen signaling pathway
WikiPathway : FSH signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : IL-1 signaling pathway
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : IL-7 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Notch Signaling Pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Signal Transduction of S1P Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : TFs Regulate miRNAs related to cardiac hypertrophy
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TOR signaling
WikiPathway : TSH signaling pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : Wnt Signaling Pathway
WikiPathway : angiogenesis overview


Cloning Information : 127841
HIP Master Clone ID : 103990
Original Clone ID : FLH127841.01X


TAX_ID : 9606
Species Specific ID: 207


Chromosome : 14
Map Location : 14q32.32
Ensembl : ENSG00000142208


Labome : Akt-antibody