DNASU Plasmid Repository • 480.965.5697 | Email

H2AFX (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  H2AFX
Gene Name:  H2A histone family, member X
Sequence             
Original Clone ID: ccsbBroadEn_00717
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC004915.2,BC011694.2,BC013416.2
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00505124

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 430nts         Open reading frame : 1 to 430
Reference Sequence Alignment

ATGTCGGGCCGCGGCAAGACTGGCGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCG
CGCGCCGGCCTCCAGTTCCCAGTGGGCCGTGTACACCGGCTGCTGCGGAAGGGCCACTAC
GCCGAGCGCGTTGGCGCCGGCGCGCCAGTGTACCTGGCGGCAGTGCTGGAGTACCTCACC
GCTGAGATCCTGGAGCTGGCGGGCAATGCGGCCCGCGACAACAAGAAGACGCGAATCATC
CCCCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCGGC
GTGACGATCGCCCAGGGAGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAG
ACCAGCGCCACCGTGGGGCCGAAGGCGCCCTCGGGCGGCAAGAAGGCCACCCAGGCCTCC
CAGGAGTAC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : H2AFX
Symbol Nomenclature : H2AFX
SYNONYM : H2A.X; H2A/X; H2AX
Designation : H2AX histone|histone H2A.x|histone H2AX
Full Nomenclature : H2A histone family, member X
GENEID : 3014
HGNC : 4739
MIM : 601772
Vega : OTTHUMG00000166196
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00505124      ATGTCGGGCCGCGGCAAGACTGGCGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCG
NM_002105.2       ATGTCGGGCCGCGGCAAGACTGGCGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCG
                  ************************************************************

HsCD00505124      CGCGCCGGCCTCCAGTTCCCAGTGGGCCGTGTACACCGGCTGCTGCGGAAGGGCCACTAC
NM_002105.2       CGCGCCGGCCTCCAGTTCCCAGTGGGCCGTGTACACCGGCTGCTGCGGAAGGGCCACTAC
                  ************************************************************

HsCD00505124      GCCGAGCGCGTTGGCGCCGGCGCGCCAGTGTACCTGGCGGCAGTGCTGGAGTACCTCACC
NM_002105.2       GCCGAGCGCGTTGGCGCCGGCGCGCCAGTGTACCTGGCGGCAGTGCTGGAGTACCTCACC
                  ************************************************************

HsCD00505124      GCTGAGATCCTGGAGCTGGCGGGCAATGCGGCCCGCGACAACAAGAAGACGCGAATCATC
NM_002105.2       GCTGAGATCCTGGAGCTGGCGGGCAATGCGGCCCGCGACAACAAGAAGACGCGAATCATC
                  ************************************************************

HsCD00505124      CCCCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCGGC
NM_002105.2       CCCCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCGGC
                  ************************************************************

HsCD00505124      GTGACGATCGCCCAGGGAGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAG
NM_002105.2       GTGACGATCGCCCAGGGAGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAG
                  ************************************************************

HsCD00505124      ACCAGCGCCACCGTGGGGCCGAAGGCGCCCTCGGGCGGCAAGAAGGCCACCCAGGCCTCC
NM_002105.2       ACCAGCGCCACCGTGGGGCCGAAGGCGCCCTCGGGCGGCAAGAAGGCCACCCAGGCCTCC
                  ************************************************************

HsCD00505124      CAGGAGTAC---
NM_002105.2       CAGGAGTACTAA
                  *********   

Pathways

NCI : ATM pathway
NCI : Fanconi anemia pathway
Reactome : ATM mediated phosphorylation of repair proteins
Reactome : ATM mediated response to DNA double-strand break
Reactome : Amyloids
Reactome : Assembly of the RAD50-MRE11-NBS1 complex at DNA double-strand breaks
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Chromosome Maintenance
Reactome : Condensation of Prophase Chromosomes
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Deposition of new CENPA-containing nucleosomes at the centromere
Reactome : Disease
Reactome : Double-Strand Break Repair
Reactome : Epigenetic regulation of gene expression
Reactome : Gene Expression
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : M Phase
Reactome : MRN complex relocalizes to nuclear foci
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Meiotic synapsis
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prophase
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : Nucleosome assembly
Reactome : Oxidative Stress Induced Senescence
Reactome : PRC2 methylates histones and DNA
Reactome : Packaging Of Telomere Ends
Reactome : RNA Polymerase I Chain Elongation
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Promoter Opening
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
Reactome : SIRT1 negatively regulates rRNA Expression
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Signal Transduction
Reactome : Signaling by Wnt
Reactome : TCF dependent signaling in response to WNT
Reactome : Telomere Maintenance
Reactome : Transcription
Reactome : formation of the beta-catenin:TCF transactivating complex
WikiPathway : DNA damage response
WikiPathway : Proteasome Degradation
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

SMART domain : H2A : Histone 2A
HPRD : 03465

Clone

Cloning Information : 605569
Original Clone ID : ccsbBroadEn_00717

Organism


TAX_ID : 9606
Species Specific ID: 3014

Genome

Chromosome : 11
Map Location : 11q23.3
Ensembl : ENSG00000188486

Reagents

Labome : H2AX-antibody