DNASU Plasmid Repository • 480.965.5697 | Email

NGEF (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NGEF
Gene Name:  neuronal guanine nucleotide exchange factor
Sequence             
Original Clone ID: ccsbBroadEn_07940
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC031573.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00505485

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2131nts         Open reading frame : 1 to 2131
Reference Sequence Alignment

ATGGAGACCAGGGAATCTGAAGATTTGGAAAAGACCCGGAGGAAATCAGCAAGTGATCAA
TGGAACACTGATAATGAACCAGCCAAGGTGAAACCTGAGTTACTCCCAGAAAAAGAGGAG
ACTTCTCAAGCTGACCAGGATATCCAAGACAAAGAGCCTCATTGCCACATCCCAATTAAG
AGAAATTCCATCTTCAATCGCTCCATAAGACGCAAAAGCAAAGCCAAGGCCAGAGACAAC
CCCGAACGGAACGCCAGCTGCCTGGCAGATTCACAGGACAATGGAAAATCTGTAAATGAG
CCCCTGACCTTGAATATCCCCTGGAGCAGAACGCCTCCTTGCAGAACAGCAATGCAGACA
GACCCAGGAGCCCAGGAAATGAGTGAGTCGTCCTCCACCCCGGGAAATGGGGCCACGCCC
GAGGAGTGGCCGGCCCTGGCCGACAGCCCCACCACGCTCACCGAGGCCCTGCGGATGATC
CACCCCATTCCCGCCGACTCCTGGAGAAACCTCATTGAACAAATAGGGCTCCTGTATCAG
GAATACCGAGATAAATCGACTCTCCAAGAAATCGAAACCAGGAGGCAACAGGATGCAGAA
ATAGAAGACAATACCAATGGGTCCCCGGCCAGTGAGGACACCCCGGAGGAGGAAGAAGAA
GAGGAGGAGGAGGAGGAGCCGGCCAGCCCACCAGAGAGGAAGACTCTGCCCCAGATCTGC
CTGCTCAGTAACCCCCACTCAAGGTTCAACCTCTGGCAGGATCTTCCCGAGATCCGGAGC
AGCGGGGTGCTTGAGATCCTACAGCCTGAGGAGATTAAGCTGCAGGAGGCCATGTTCGAG
CTGGTCACTTCCGAGGCGTCCTACTACAAGAGTCTGAACCTGCTCGTGTCCCACTTCATG
GAGAACGAGCGGATAAGGAAGATCCTGCACCCGTCCGAGGCGCACATCCTCTTCTCCAAC
GTCCTGGACGTGCTGGCTGTCAGTGAGCGGTTCCTCCTGGAGCTGGAGCACCGGATGGAG
GAGAACATCGTCATCTCTGACGTGTGTGACATCGTGTACCGTTATGCGGCTGACCACTTC
TCTGTCTACATCACCTACGTCAGCAATCAGACCTACCAGGAGCGGACCTATAAGCAGCTG
CTCCAGGAGAAGGCAGCTTTCCGGGAGCTGATCGCGCAGCTAGAGCTCGACCCCAAGTGC
AGGGGGCTGCCCTTCTCCTCCTTCCTCATCCTGCCTTTCCAGAGGATCACACGCCTCAAG
CTGTTGGTCCAGAACATCCTGAAGAGGGTAGAAGAGAGGTCTGAGCGGGAGTGCACTGCT
TTGGATGCTCACAAGGAGCTGGAAATGGTGGTGAAGGCATGCAACGAGGGCGTCAGGAAA
ATGAGCCGCACGGAACAGATGATCAGCATTCAGAAGAAGATGGAGTTCAAGATCAAGTCG
GTGCCCATCATCTCCCACTCCCGCTGGCTGCTGAAGCAGGGTGAGCTGCAGCAGATGTCA
GGCCCCAAGACCTCCCGGACCCTGAGGACCAAGAAGCTCTTCCACGAAATTTACCTCTTC
CTGTTCAACGACCTGCTGGTGATCTGCCGGCAGATTCCAGGAGACAAGTACCAGGTATTT
GACTCAGCTCCGCGGGGACTGCTGCGTGTGGAGGAGCTGGAGGACCAGGGCCAGACGCTG
GCCAACGTGTTCATCCTGCGGCTGCTGGAGAACGCAGATGACCGGGAGGCCACCTACATG
CTAAAGGCGTCCTCTCAGAGTGAGATGAAGCGTTGGATGACCTCACTGGCCCCCAACAGG
AGGACCAAGTTTGTTTCGTTCACATCCCGGCTGCTGGACTGCCCCCAGGTCCAGTGCGTG
CACCCATACGTGGCTCAGCAGCCAGACGAGCTGACGCTGGAGCTCGCCGACATCCTCAAC
ATCCTGGACAAGACTGACGACGGGTGGATCTTTGGCGAGCGTCTGCACGACCAGGAGAGA
GGCTGGTTCCCCAGCTCCATGACTGAGGAGATCTTGAATCCCAAGATCCGGTCCCAGAAC
CTCAAGGAATGTTTCCGTGTCCACAAGATGGATGACCCTCAGCGCAGCCAGAACAAGGAC
CGCAGGAAGCTGGGCAGCCGGAATCGGCAA


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NGEF
Symbol Nomenclature : NGEF
SYNONYM : ARHGEF27; EPHEXIN
Designation : eph-interacting exchange protein|ephexin-1
Full Nomenclature : neuronal guanine nucleotide exchange factor
GENEID : 25791
GenBank Accession : DQ893998
HGNC : 7807
MIM : 605991
Vega : OTTHUMG00000133272
Target GenBank: DQ893998

 

Reference Sequence Alignment

  

HsCD00505485      ATGGAGACCAGGGAATCTGAAGATTTGGAAAAGACCCGGAGGAAATCAGCAAGTGATCAA
NM_019850.2       ATGGAGACCAGGGAATCTGAAGATTTGGAAAAGACCCGGAGGAAATCAGCAAGTGATCAA
                  ************************************************************

HsCD00505485      TGGAACACTGATAATGAACCAGCCAAGGTGAAACCTGAGTTACTCCCAGAAAAAGAGGAG
NM_019850.2       TGGAACACTGATAATGAACCAGCCAAGGTGAAACCTGAGTTACTCCCAGAAAAAGAGGAG
                  ************************************************************

HsCD00505485      ACTTCTCAAGCTGACCAGGATATCCAAGACAAAGAGCCTCATTGCCACATCCCAATTAAG
NM_019850.2       ACTTCTCAAGCTGACCAGGATATCCAAGACAAAGAGCCTCATTGCCACATCCCAATTAAG
                  ************************************************************

HsCD00505485      AGAAATTCCATCTTCAATCGCTCCATAAGACGCAAAAGCAAAGCCAAGGCCAGAGACAAC
NM_019850.2       AGAAATTCCATCTTCAATCGCTCCATAAGACGCAAAAGCAAAGCCAAGGCCAGAGACAAC
                  ************************************************************

HsCD00505485      CCCGAACGGAACGCCAGCTGCCTGGCAGATTCACAGGACAATGGAAAATCTGTAAATGAG
NM_019850.2       CCCGAACGGAACGCCAGCTGCCTGGCAGATTCACAGGACAATGGAAAATCTGTAAATGAG
                  ************************************************************

HsCD00505485      CCCCTGACCTTGAATATCCCCTGGAGCAGAACGCCTCCTTGCAGAACAGCAATGCAGACA
NM_019850.2       CCCCTGACCTTGAATATCCCCTGGAGCAGAATGCCTCCTTGCAGAACAGCAATGCAGACA
                  ******************************* ****************************

HsCD00505485      GACCCAGGAGCCCAGGAAATGAGTGAGTCGTCCTCCACCCCGGGAAATGGGGCCACGCCC
NM_019850.2       GACCCAGGAGCCCAGGAAATGAGTGAGTCGTCCTCCACCCCGGGAAATGGGGCCACGCCC
                  ************************************************************

HsCD00505485      GAGGAGTGGCCGGCCCTGGCCGACAGCCCCACCACGCTCACCGAGGCCCTGCGGATGATC
NM_019850.2       GAGGAGTGGCCGGCCCTGGCCGACAGCCCCACCACGCTCACCGAGGCCCTGCGGATGATC
                  ************************************************************

HsCD00505485      CACCCCATTCCCGCCGACTCCTGGAGAAACCTCATTGAACAAATAGGGCTCCTGTATCAG
NM_019850.2       CACCCCATTCCCGCCGACTCCTGGAGAAACCTCATTGAACAAATAGGGCTCCTGTATCAG
                  ************************************************************

HsCD00505485      GAATACCGAGATAAATCGACTCTCCAAGAAATCGAAACCAGGAGGCAACAGGATGCAGAA
NM_019850.2       GAATACCGAGATAAATCGACTCTCCAAGAAATCGAAACCAGGAGGCAACAGGATGCAGAA
                  ************************************************************

HsCD00505485      ATAGAAGACAATACCAATGGGTCCCCGGCCAGTGAGGACACCCCGGAGGAGGAAGAAGAA
NM_019850.2       ATAGAAGACAATACCAATGGGTCCCCGGCCAGTGAGGACACCCCGGAGGAGGAAGAAGAA
                  ************************************************************

HsCD00505485      GAGGAGGAGGAGGAGGAGCCGGCCAGCCCACCAGAGAGGAAGACTCTGCCCCAGATCTGC
NM_019850.2       GAGGAGGAGGAGGAGGAGCCGGCCAGCCCACCAGAGAGGAAGACTCTGCCCCAGATCTGC
                  ************************************************************

HsCD00505485      CTGCTCAGTAACCCCCACTCAAGGTTCAACCTCTGGCAGGATCTTCCCGAGATCCGGAGC
NM_019850.2       CTGCTCAGTAACCCCCACTCAAGGTTCAACCTCTGGCAGGATCTTCCCGAGATCCGGAGC
                  ************************************************************

HsCD00505485      AGCGGGGTGCTTGAGATCCTACAGCCTGAGGAGATTAAGCTGCAGGAGGCCATGTTCGAG
NM_019850.2       AGCGGGGTGCTTGAGATCCTACAGCCCGAGGAGATTAAGCTGCAGGAGGCCATGTTCGAG
                  ************************** *********************************

HsCD00505485      CTGGTCACTTCCGAGGCGTCCTACTACAAGAGTCTGAACCTGCTCGTGTCCCACTTCATG
NM_019850.2       CTGGTCACTTCCGAGGCGTCCTACTACAAGAGTCTGAACCTGCTCGTGTCCCACTTCATG
                  ************************************************************

HsCD00505485      GAGAACGAGCGGATAAGGAAGATCCTGCACCCGTCCGAGGCGCACATCCTCTTCTCCAAC
NM_019850.2       GAGAACGAGCGGATAAGGAAGATCCTGCACCCGTCCGAGGCGCACATCCTCTTCTCCAAC
                  ************************************************************

HsCD00505485      GTCCTGGACGTGCTGGCTGTCAGTGAGCGGTTCCTCCTGGAGCTGGAGCACCGGATGGAG
NM_019850.2       GTCCTGGACGTGCTGGCTGTCAGTGAGCGGTTCCTCCTGGAGCTGGAGCACCGGATGGAG
                  ************************************************************

HsCD00505485      GAGAACATCGTCATCTCTGACGTGTGTGACATCGTGTACCGTTATGCGGCTGACCACTTC
NM_019850.2       GAGAACATCGTCATCTCTGACGTGTGTGACATTGTGTACCGTTATGCGGCCGACCACTTC
                  ******************************** ***************** *********

HsCD00505485      TCTGTCTACATCACCTACGTCAGCAATCAGACCTACCAGGAGCGGACCTATAAGCAGCTG
NM_019850.2       TCTGTCTACATCACCTACGTCAGCAATCAGACCTACCAGGAGCGGACCTATAAGCAGCTG
                  ************************************************************

HsCD00505485      CTCCAGGAGAAGGCAGCTTTCCGGGAGCTGATCGCGCAGCTAGAGCTCGACCCCAAGTGC
NM_019850.2       CTCCAGGAGAAGGCAGCTTTCCGGGAGCTGATCGCGCAGCTAGAGCTCGACCCCAAGTGC
                  ************************************************************

HsCD00505485      AGGGGGCTGCCCTTCTCCTCCTTCCTCATCCTGCCTTTCCAGAGGATCACACGCCTCAAG
NM_019850.2       AGGGGGCTGCCCTTCTCCTCCTTCCTCATCCTGCCTTTCCAGAGGATCACACGCCTCAAG
                  ************************************************************

HsCD00505485      CTGTTGGTCCAGAACATCCTGAAGAGGGTAGAAGAGAGGTCTGAGCGGGAGTGCACTGCT
NM_019850.2       CTGTTGGTCCAGAACATCCTGAAGAGGGTAGAAGAGAGGTCTGAGCGGGAGTGCACTGCT
                  ************************************************************

HsCD00505485      TTGGATGCTCACAAGGAGCTGGAAATGGTGGTGAAGGCATGCAACGAGGGCGTCAGGAAA
NM_019850.2       TTGGATGCTCACAAGGAGCTGGAAATGGTGGTGAAGGCATGCAACGAGGGCGTCAGGAAA
                  ************************************************************

HsCD00505485      ATGAGCCGCACGGAACAGATGATCAGCATTCAGAAGAAGATGGAGTTCAAGATCAAGTCG
NM_019850.2       ATGAGCCGCACGGAACAGATGATCAGCATTCAGAAGAAGATGGAGTTCAAGATCAAGTCG
                  ************************************************************

HsCD00505485      GTGCCCATCATCTCCCACTCCCGCTGGCTGCTGAAGCAGGGTGAGCTGCAGCAGATGTCA
NM_019850.2       GTGCCCATCATCTCCCACTCCCGCTGGCTGCTGAAGCAGGGTGAGCTGCAGCAGATGTCA
                  ************************************************************

HsCD00505485      GGCCCCAAGACCTCCCGGACCCTGAGGACCAAGAAGCTCTTCCACGAAATTTACCTCTTC
NM_019850.2       GGCCCCAAGACCTCCCGGACCCTGAGGACCAAGAAGCTCTTCCACGAAATTTACCTCTTC
                  ************************************************************

HsCD00505485      CTGTTCAACGACCTGCTGGTGATCTGCCGGCAGATTCCAGGAGACAAGTACCAGGTATTT
NM_019850.2       CTGTTCAACGACCTGCTGGTGATCTGCCGGCAGATTCCAGGAGACAAGTACCAGGTATTT
                  ************************************************************

HsCD00505485      GACTCAGCTCCGCGGGGACTGCTGCGTGTGGAGGAGCTGGAGGACCAGGGCCAGACGCTG
NM_019850.2       GACTCAGCTCCGCGGGGACTGCTGCGTGTGGAGGAGCTGGAGGACCAGGGCCAGACGCTG
                  ************************************************************

HsCD00505485      GCCAACGTGTTCATCCTGCGGCTGCTGGAGAACGCAGATGACCGGGAGGCCACCTACATG
NM_019850.2       GCCAACGTGTTCATCCTGCGGCTGCTGGAGAACGCAGATGACCGGGAGGCCACCTACATG
                  ************************************************************

HsCD00505485      CTAAAGGCGTCCTCTCAGAGTGAGATGAAGCGTTGGATGACCTCACTGGCCCCCAACAGG
NM_019850.2       CTAAAGGCGTCCTCTCAGAGTGAGATGAAGCGTTGGATGACCTCACTGGCCCCCAACAGG
                  ************************************************************

HsCD00505485      AGGACCAAGTTTGTTTCGTTCACATCCCGGCTGCTGGACTGCCCCCAGGTCCAGTGCGTG
NM_019850.2       AGGACCAAGTTTGTTTCGTTCACATCCCGGCTGCTGGACTGCCCCCAGGTCCAGTGCGTG
                  ************************************************************

HsCD00505485      CACCCATACGTGGCTCAGCAGCCAGACGAGCTGACGCTGGAGCTCGCCGACATCCTCAAC
NM_019850.2       CACCCATACGTGGCTCAGCAGCCAGACGAGCTGACGCTGGAGCTCGCCGACATCCTCAAC
                  ************************************************************

HsCD00505485      ATCCTGGACAAGACTGACGACGGGTGGATCTTTGGCGAGCGTCTGCACGACCAGGAGAGA
NM_019850.2       ATCCTGGACAAGACTGACGACGGGTGGATCTTTGGCGAGCGTCTGCACGACCAGGAGAGA
                  ************************************************************

HsCD00505485      GGCTGGTTCCCCAGCTCCATGACTGAGGAGATCTTGAATCCCAAGATCCGGTCCCAGAAC
NM_019850.2       GGCTGGTTCCCCAGCTCCATGACTGAGGAGATCTTGAATCCCAAGATCCGGTCCCAGAAC
                  ************************************************************

HsCD00505485      CTCAAGGAATGTTTCCGTGTCCACAAGATGGATGACCCTCAGCGCAGCCAGAACAAGGAC
NM_019850.2       CTCAAGGAATGTTTCCGTGTCCACAAGATGGATGACCCTCAGCGCAGCCAGAACAAGGAC
                  ************************************************************

HsCD00505485      CGCAGGAAGCTGGGCAGCCGGAATCGGCAA---
NM_019850.2       CGCAGGAAGCTGGGCAGCCGGAATCGGCAATGA
                  ******************************   

Pathways

NCI : EPHA forward signaling
NCI : Regulation of CDC42 activity
NCI : Regulation of RAC1 activity
NCI : Regulation of RhoA activity
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : G alpha (12/13) signalling events
Reactome : GPCR downstream signaling
Reactome : NRAGE signals death through JNK
Reactome : Rho GTPase cycle
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signaling by Rho GTPases
Reactome : Signalling by NGF
Reactome : p75 NTR receptor-mediated signalling

Clone

Cloning Information : 614460
Original Clone ID : ccsbBroadEn_07940

Organism


TAX_ID : 9606
Species Specific ID: 25791

Genome

Chromosome : 2
Map Location : 2q37
Ensembl : ENSG00000066248

Reagents

Labome : NGEF-antibody