DNASU Plasmid Repository • 480.965.5697 | Email

ITGB2 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ITGB2
Gene Name:  integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
Sequence             
Original Clone ID: ccsbBroadEn_06464
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC005861.2
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Harvard Medical School
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
The ORFeome Collaboration
HsCD00505665

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2308nts        
Open reading frame : 1 to 2308
Reference Sequence Alignment

ATGCTGGGCCTGCGCCCCCCACTTCTCGCCCTGGTGGGGCTGCTCTCCCTCGGGTGCGTC
CTCTCTCAGGAGTGCACGAAGTTCAAGGTCAGCAGCTGCCGGGAATGCATCGAGTCGGGG
CCCGGCTGCACCTGGTGCCAGAAGCTGAACTTCACAGGGCCGGGGGATCCTGACTCCATT
CGCTGCGACACCCGGCCACAGCTGCTCATGAGGGGCTGTGCGGCTGACGACATCATGGAC
CCCACAAGCCTCGCTGAAACCCAGGAAGACCACAATGGGGGCCAGAAGCAGCTGTCCCCA
CAAAAAGTGACGCTTTACCTGCGACCAGGCCAGGCAGCAGCGTTCAACGTGACCTTCCGG
CGGGCCAAGGGCTACCCCATCGACCTGTACTATCTGATGGACCTCTCCTACTCCATGCTT
GATGACCTCAGGAATGTCAAGAAGCTAGGTGGCGACCTGCTCCGGGCCCTCAACGAGATC
ACCGAGTCCGGCCGCATTGGCTTCGGGTCCTTCGTGGACAAGACCGTGCTGCCGTTCGTG
AACACGCACCCTGATAAGCTGCGAAACCCATGCCCCAACAAGGAGAAAGAGTGCCAGCCC
CCGTTTGCCTTCAGGCACGTGCTGAAGCTGACCAACAACTCCAACCAGTTTCAGACCGAG
GTCGGGAAGCAGCTGATTTCCGGAAACCTGGATGCACCCGAGGGTGGGCTGGACGCCATG
ATGCAGGTCGCCGCCTGCCCGGAGGAAATCGGCTGGCGCAACGTCACGCGGCTGCTGGTG
TTTGCCACTGATGACGGCTTCCATTTCGCGGGCGACGGGAAGCTGGGCGCCATCCTGACC
CCCAACGACGGCCGCTGTCACCTGGAGGACAACTTGTACAAGAGGAGCAACGAATTCGAC
TACCCATCGGTGGGCCAGCTGGCGCACAAGCTGGCTGAAAACAACATCCAGCCCATCTTC
GCGGTGACCAGTAGGATGGTGAAGACCTACGAGAAACTCACCGAGATCATCCCCAAGTCA
GCCGTGGGGGAGCTGTCTGAGGACTCCAGCAATGTGGTCCATCTCATTAAGAATGCTTAC
AATAAACTCTCCTCCAGGGTATTCCTGGATCACAACGCCCTCCCCGACACCCTGAAAGTC
ACCTACGACTCCTTCTGCAGCAATGGAGTGACGCACAGGAACCAGCCCAGAGGTGACTGT
GATGGCGTGCAGATCAATGTCCCGATCACCTTCCAGGTGAAGGTCACGGCCACAGAGTGC
ATCCAGGAGCAGTCGTTTGTCATCCGGGCGCTGGGCTTCACGGACATAGTGACCGTGCAG
GTCCTTCCCCAGTGTGAGTGCCGGTGCCGGGACCAGAGCAGAGACCGCAGCCTCTGCCAT
GGCAAGGGCTTCTTGGAGTGCGGCATCTGCAGGTGTGACACTGGCTACATTGGGAAAAAC
TGTGAGTGCCAGACACAGGGCCGGAGCAGCCAGGAGCTGGAAGGAAGCTGCCGGAAGGAC
AACAACTCCATCATCTGCTCAGGGCTGGGGGACTGTGTCTGCGGGCAGTGCCTGTGCCAC
ACCAGCGACGTCCCCGGCAAGCTGATATACGGGCAGTACTGCGAGTGTGACACCATCAAC
TGTGAGCGCTACAACGGCCAGGTCTGCGGCGGCCCGGGGAGGGGGCTCTGCTTCTGCGGG
AAGTGCCGCTGCCACCCGGGCTTTGAGGGCTCAGCGTGCCAGTGCGAGAGGACCACTGAG
GGCTGCCTGAACCCGCGGCGTGTTGAGTGTAGTGGTCGTGGCCGGTGCCGCTGCAACGTA
TGCGAGTGCCATTCAGGCTACCAGCTGCCTCTGTGCCAGGAGTGCCCCGGCTGCCCCTCA
CCCTGTGGCAAGTACATCTCCTGCGCCGAGTGCCTGAAGTTCGAAAAGGGCCCCTTTGGG
AAGAACTGCAGCGCGGCGTGTCCGGGCCTGCAGCTGTCGAACAACCCCGTGAAGGGCAGG
ACCTGCAAGGAGAGGGACTCAGAGGGCTGCTGGGTGGCCTACACGCTGGAGCAGCAGGAC
GGGATGGACCGCTACCTCATCTATGTGGATGAGAGCCGAGAGTGTGTGGCAGGCCCCAAC
ATCGCCGCCATCGTCGGGGGCACCGTGGCAGGCATCGTGCTGATCGGCATTCTCCTGCTG
GTCATCTGGAAGGCTCTGATCCACCTGAGCGACCTCCGGGAGTACAGGCGCTTTGAGAAG
GAGAAGCTCAAGTCCCAGTGGAACAATGATAATCCCCTTTTCAAGAGCGCCACCACGACG
GTCATGAACCCCAAGTTTGCTGAGAGT


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ITGB2
Symbol Nomenclature : ITGB2
SYNONYM : CD18; LAD; LCAMB; LFA-1; MAC-1; MF17; MFI7
Designation : cell surface adhesion glycoprotein LFA-1/CR3/P150,959 beta subunit precursor)|cell surface adhesion glycoproteins LFA-1/CR3/p150,95 subunit beta|complement receptor C3 beta-subunit|complement receptor C3 subunit beta|integrin beta chain, beta 2|integrin beta-2|leukocyte cell adhesion molecule CD18|leukocyte-associated antigens CD18/11A, CD18/11B, CD18/11C
Full Nomenclature : integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
GENEID : 3689
GenBank Accession : EU832689
HGNC : 6155
MIM : 600065
Vega : OTTHUMG00000090257
Target GenBank: EU832689

 

Reference Sequence Alignment

  

HsCD00505665        ATGCTGGGCCTGCGCCCCCCACTTCTCGCCCTGGTGGGGCTGCTCTCCCTCGGGTGCGTC
NM_000211.3         ATGCTGGGCCTGCGCCCCCCACTGCTCGCCCTGGTGGGGCTGCTCTCCCTCGGGTGCGTC
NM_001127491.1      ATGCTGGGCCTGCGCCCCCCACTGCTCGCCCTGGTGGGGCTGCTCTCCCTCGGGTGCGTC
                    *********************** ************************************

HsCD00505665        CTCTCTCAGGAGTGCACGAAGTTCAAGGTCAGCAGCTGCCGGGAATGCATCGAGTCGGGG
NM_000211.3         CTCTCTCAGGAGTGCACGAAGTTCAAGGTCAGCAGCTGCCGGGAATGCATCGAGTCGGGG
NM_001127491.1      CTCTCTCAGGAGTGCACGAAGTTCAAGGTCAGCAGCTGCCGGGAATGCATCGAGTCGGGG
                    ************************************************************

HsCD00505665        CCCGGCTGCACCTGGTGCCAGAAGCTGAACTTCACAGGGCCGGGGGATCCTGACTCCATT
NM_000211.3         CCCGGCTGCACCTGGTGCCAGAAGCTGAACTTCACAGGGCCGGGGGATCCTGACTCCATT
NM_001127491.1      CCCGGCTGCACCTGGTGCCAGAAGCTGAACTTCACAGGGCCGGGGGATCCTGACTCCATT
                    ************************************************************

HsCD00505665        CGCTGCGACACCCGGCCACAGCTGCTCATGAGGGGCTGTGCGGCTGACGACATCATGGAC
NM_000211.3         CGCTGCGACACCCGGCCACAGCTGCTCATGAGGGGCTGTGCGGCTGACGACATCATGGAC
NM_001127491.1      CGCTGCGACACCCGGCCACAGCTGCTCATGAGGGGCTGTGCGGCTGACGACATCATGGAC
                    ************************************************************

HsCD00505665        CCCACAAGCCTCGCTGAAACCCAGGAAGACCACAATGGGGGCCAGAAGCAGCTGTCCCCA
NM_000211.3         CCCACAAGCCTCGCTGAAACCCAGGAAGACCACAATGGGGGCCAGAAGCAGCTGTCCCCA
NM_001127491.1      CCCACAAGCCTCGCTGAAACCCAGGAAGACCACAATGGGGGCCAGAAGCAGCTGTCCCCA
                    ************************************************************

HsCD00505665        CAAAAAGTGACGCTTTACCTGCGACCAGGCCAGGCAGCAGCGTTCAACGTGACCTTCCGG
NM_000211.3         CAAAAAGTGACGCTTTACCTGCGACCAGGCCAGGCAGCAGCGTTCAACGTGACCTTCCGG
NM_001127491.1      CAAAAAGTGACGCTTTACCTGCGACCAGGCCAGGCAGCAGCGTTCAACGTGACCTTCCGG
                    ************************************************************

HsCD00505665        CGGGCCAAGGGCTACCCCATCGACCTGTACTATCTGATGGACCTCTCCTACTCCATGCTT
NM_000211.3         CGGGCCAAGGGCTACCCCATCGACCTGTACTATCTGATGGACCTCTCCTACTCCATGCTT
NM_001127491.1      CGGGCCAAGGGCTACCCCATCGACCTGTACTATCTGATGGACCTCTCCTACTCCATGCTT
                    ************************************************************

HsCD00505665        GATGACCTCAGGAATGTCAAGAAGCTAGGTGGCGACCTGCTCCGGGCCCTCAACGAGATC
NM_000211.3         GATGACCTCAGGAATGTCAAGAAGCTAGGTGGCGACCTGCTCCGGGCCCTCAACGAGATC
NM_001127491.1      GATGACCTCAGGAATGTCAAGAAGCTAGGTGGCGACCTGCTCCGGGCCCTCAACGAGATC
                    ************************************************************

HsCD00505665        ACCGAGTCCGGCCGCATTGGCTTCGGGTCCTTCGTGGACAAGACCGTGCTGCCGTTCGTG
NM_000211.3         ACCGAGTCCGGCCGCATTGGCTTCGGGTCCTTCGTGGACAAGACCGTGCTGCCGTTCGTG
NM_001127491.1      ACCGAGTCCGGCCGCATTGGCTTCGGGTCCTTCGTGGACAAGACCGTGCTGCCGTTCGTG
                    ************************************************************

HsCD00505665        AACACGCACCCTGATAAGCTGCGAAACCCATGCCCCAACAAGGAGAAAGAGTGCCAGCCC
NM_000211.3         AACACGCACCCTGATAAGCTGCGAAACCCATGCCCCAACAAGGAGAAAGAGTGCCAGCCC
NM_001127491.1      AACACGCACCCTGATAAGCTGCGAAACCCATGCCCCAACAAGGAGAAAGAGTGCCAGCCC
                    ************************************************************

HsCD00505665        CCGTTTGCCTTCAGGCACGTGCTGAAGCTGACCAACAACTCCAACCAGTTTCAGACCGAG
NM_000211.3         CCGTTTGCCTTCAGGCACGTGCTGAAGCTGACCAACAACTCCAACCAGTTTCAGACCGAG
NM_001127491.1      CCGTTTGCCTTCAGGCACGTGCTGAAGCTGACCAACAACTCCAACCAGTTTCAGACCGAG
                    ************************************************************

HsCD00505665        GTCGGGAAGCAGCTGATTTCCGGAAACCTGGATGCACCCGAGGGTGGGCTGGACGCCATG
NM_000211.3         GTCGGGAAGCAGCTGATTTCCGGAAACCTGGATGCACCCGAGGGTGGGCTGGACGCCATG
NM_001127491.1      GTCGGGAAGCAGCTGATTTCCGGAAACCTGGATGCACCCGAGGGTGGGCTGGACGCCATG
                    ************************************************************

HsCD00505665        ATGCAGGTCGCCGCCTGCCCGGAGGAAATCGGCTGGCGCAACGTCACGCGGCTGCTGGTG
NM_000211.3         ATGCAGGTCGCCGCCTGCCCGGAGGAAATCGGCTGGCGCAACGTCACGCGGCTGCTGGTG
NM_001127491.1      ATGCAGGTCGCCGCCTGCCCGGAGGAAATCGGCTGGCGCAACGTCACGCGGCTGCTGGTG
                    ************************************************************

HsCD00505665        TTTGCCACTGATGACGGCTTCCATTTCGCGGGCGACGGGAAGCTGGGCGCCATCCTGACC
NM_000211.3         TTTGCCACTGATGACGGCTTCCATTTCGCGGGCGACGGGAAGCTGGGCGCCATCCTGACC
NM_001127491.1      TTTGCCACTGATGACGGCTTCCATTTCGCGGGCGACGGGAAGCTGGGCGCCATCCTGACC
                    ************************************************************

HsCD00505665        CCCAACGACGGCCGCTGTCACCTGGAGGACAACTTGTACAAGAGGAGCAACGAATTCGAC
NM_000211.3         CCCAACGACGGCCGCTGTCACCTGGAGGACAACTTGTACAAGAGGAGCAACGAATTCGAC
NM_001127491.1      CCCAACGACGGCCGCTGTCACCTGGAGGACAACTTGTACAAGAGGAGCAACGAATTCGAC
                    ************************************************************

HsCD00505665        TACCCATCGGTGGGCCAGCTGGCGCACAAGCTGGCTGAAAACAACATCCAGCCCATCTTC
NM_000211.3         TACCCATCGGTGGGCCAGCTGGCGCACAAGCTGGCTGAAAACAACATCCAGCCCATCTTC
NM_001127491.1      TACCCATCGGTGGGCCAGCTGGCGCACAAGCTGGCTGAAAACAACATCCAGCCCATCTTC
                    ************************************************************

HsCD00505665        GCGGTGACCAGTAGGATGGTGAAGACCTACGAGAAACTCACCGAGATCATCCCCAAGTCA
NM_000211.3         GCGGTGACCAGTAGGATGGTGAAGACCTACGAGAAACTCACCGAGATCATCCCCAAGTCA
NM_001127491.1      GCGGTGACCAGTAGGATGGTGAAGACCTACGAGAAACTCACCGAGATCATCCCCAAGTCA
                    ************************************************************

HsCD00505665        GCCGTGGGGGAGCTGTCTGAGGACTCCAGCAATGTGGTCCATCTCATTAAGAATGCTTAC
NM_000211.3         GCCGTGGGGGAGCTGTCTGAGGACTCCAGCAATGTGGTCCAACTCATTAAGAATGCTTAC
NM_001127491.1      GCCGTGGGGGAGCTGTCTGAGGACTCCAGCAATGTGGTCCAACTCATTAAGAATGCTTAC
                    *****************************************:******************

HsCD00505665        AATAAACTCTCCTCCAGGGTATTCCTGGATCACAACGCCCTCCCCGACACCCTGAAAGTC
NM_000211.3         AATAAACTCTCCTCCAGGGTCTTCCTGGATCACAACGCCCTCCCCGACACCCTGAAAGTC
NM_001127491.1      AATAAACTCTCCTCCAGGGTCTTCCTGGATCACAACGCCCTCCCCGACACCCTGAAAGTC
                    ********************.***************************************

HsCD00505665        ACCTACGACTCCTTCTGCAGCAATGGAGTGACGCACAGGAACCAGCCCAGAGGTGACTGT
NM_000211.3         ACCTACGACTCCTTCTGCAGCAATGGAGTGACGCACAGGAACCAGCCCAGAGGTGACTGT
NM_001127491.1      ACCTACGACTCCTTCTGCAGCAATGGAGTGACGCACAGGAACCAGCCCAGAGGTGACTGT
                    ************************************************************

HsCD00505665        GATGGCGTGCAGATCAATGTCCCGATCACCTTCCAGGTGAAGGTCACGGCCACAGAGTGC
NM_000211.3         GATGGCGTGCAGATCAATGTCCCGATCACCTTCCAGGTGAAGGTCACGGCCACAGAGTGC
NM_001127491.1      GATGGCGTGCAGATCAATGTCCCGATCACCTTCCAGGTGAAGGTCACGGCCACAGAGTGC
                    ************************************************************

HsCD00505665        ATCCAGGAGCAGTCGTTTGTCATCCGGGCGCTGGGCTTCACGGACATAGTGACCGTGCAG
NM_000211.3         ATCCAGGAGCAGTCGTTTGTCATCCGGGCGCTGGGCTTCACGGACATAGTGACCGTGCAG
NM_001127491.1      ATCCAGGAGCAGTCGTTTGTCATCCGGGCGCTGGGCTTCACGGACATAGTGACCGTGCAG
                    ************************************************************

HsCD00505665        GTCCTTCCCCAGTGTGAGTGCCGGTGCCGGGACCAGAGCAGAGACCGCAGCCTCTGCCAT
NM_000211.3         GTTCTTCCCCAGTGTGAGTGCCGGTGCCGGGACCAGAGCAGAGACCGCAGCCTCTGCCAT
NM_001127491.1      GTTCTTCCCCAGTGTGAGTGCCGGTGCCGGGACCAGAGCAGAGACCGCAGCCTCTGCCAT
                    ** *********************************************************

HsCD00505665        GGCAAGGGCTTCTTGGAGTGCGGCATCTGCAGGTGTGACACTGGCTACATTGGGAAAAAC
NM_000211.3         GGCAAGGGCTTCTTGGAGTGCGGCATCTGCAGGTGTGACACTGGCTACATTGGGAAAAAC
NM_001127491.1      GGCAAGGGCTTCTTGGAGTGCGGCATCTGCAGGTGTGACACTGGCTACATTGGGAAAAAC
                    ************************************************************

HsCD00505665        TGTGAGTGCCAGACACAGGGCCGGAGCAGCCAGGAGCTGGAAGGAAGCTGCCGGAAGGAC
NM_000211.3         TGTGAGTGCCAGACACAGGGCCGGAGCAGCCAGGAGCTGGAAGGAAGCTGCCGGAAGGAC
NM_001127491.1      TGTGAGTGCCAGACACAGGGCCGGAGCAGCCAGGAGCTGGAAGGAAGCTGCCGGAAGGAC
                    ************************************************************

HsCD00505665        AACAACTCCATCATCTGCTCAGGGCTGGGGGACTGTGTCTGCGGGCAGTGCCTGTGCCAC
NM_000211.3         AACAACTCCATCATCTGCTCAGGGCTGGGGGACTGTGTCTGCGGGCAGTGCCTGTGCCAC
NM_001127491.1      AACAACTCCATCATCTGCTCAGGGCTGGGGGACTGTGTCTGCGGGCAGTGCCTGTGCCAC
                    ************************************************************

HsCD00505665        ACCAGCGACGTCCCCGGCAAGCTGATATACGGGCAGTACTGCGAGTGTGACACCATCAAC
NM_000211.3         ACCAGCGACGTCCCCGGCAAGCTGATATACGGGCAGTACTGCGAGTGTGACACCATCAAC
NM_001127491.1      ACCAGCGACGTCCCCGGCAAGCTGATATACGGGCAGTACTGCGAGTGTGACACCATCAAC
                    ************************************************************

HsCD00505665        TGTGAGCGCTACAACGGCCAGGTCTGCGGCGGCCCGGGGAGGGGGCTCTGCTTCTGCGGG
NM_000211.3         TGTGAGCGCTACAACGGCCAGGTCTGCGGCGGCCCGGGGAGGGGGCTCTGCTTCTGCGGG
NM_001127491.1      TGTGAGCGCTACAACGGCCAGGTCTGCGGCGGCCCGGGGAGGGGGCTCTGCTTCTGCGGG
                    ************************************************************

HsCD00505665        AAGTGCCGCTGCCACCCGGGCTTTGAGGGCTCAGCGTGCCAGTGCGAGAGGACCACTGAG
NM_000211.3         AAGTGCCGCTGCCACCCGGGCTTTGAGGGCTCAGCGTGCCAGTGCGAGAGGACCACTGAG
NM_001127491.1      AAGTGCCGCTGCCACCCGGGCTTTGAGGGCTCAGCGTGCCAGTGCGAGAGGACCACTGAG
                    ************************************************************

HsCD00505665        GGCTGCCTGAACCCGCGGCGTGTTGAGTGTAGTGGTCGTGGCCGGTGCCGCTGCAACGTA
NM_000211.3         GGCTGCCTGAACCCGCGGCGTGTTGAGTGTAGTGGTCGTGGCCGGTGCCGCTGCAACGTA
NM_001127491.1      GGCTGCCTGAACCCGCGGCGTGTTGAGTGTAGTGGTCGTGGCCGGTGCCGCTGCAACGTA
                    ************************************************************

HsCD00505665        TGCGAGTGCCATTCAGGCTACCAGCTGCCTCTGTGCCAGGAGTGCCCCGGCTGCCCCTCA
NM_000211.3         TGCGAGTGCCATTCAGGCTACCAGCTGCCTCTGTGCCAGGAGTGCCCCGGCTGCCCCTCA
NM_001127491.1      TGCGAGTGCCATTCAGGCTACCAGCTGCCTCTGTGCCAGGAGTGCCCCGGCTGCCCCTCA
                    ************************************************************

HsCD00505665        CCCTGTGGCAAGTACATCTCCTGCGCCGAGTGCCTGAAGTTCGAAAAGGGCCCCTTTGGG
NM_000211.3         CCCTGTGGCAAGTACATCTCCTGCGCCGAGTGCCTGAAGTTCGAAAAGGGCCCCTTTGGG
NM_001127491.1      CCCTGTGGCAAGTACATCTCCTGCGCCGAGTGCCTGAAGTTCGAAAAGGGCCCCTTTGGG
                    ************************************************************

HsCD00505665        AAGAACTGCAGCGCGGCGTGTCCGGGCCTGCAGCTGTCGAACAACCCCGTGAAGGGCAGG
NM_000211.3         AAGAACTGCAGCGCGGCGTGTCCGGGCCTGCAGCTGTCGAACAACCCCGTGAAGGGCAGG
NM_001127491.1      AAGAACTGCAGCGCGGCGTGTCCGGGCCTGCAGCTGTCGAACAACCCCGTGAAGGGCAGG
                    ************************************************************

HsCD00505665        ACCTGCAAGGAGAGGGACTCAGAGGGCTGCTGGGTGGCCTACACGCTGGAGCAGCAGGAC
NM_000211.3         ACCTGCAAGGAGAGGGACTCAGAGGGCTGCTGGGTGGCCTACACGCTGGAGCAGCAGGAC
NM_001127491.1      ACCTGCAAGGAGAGGGACTCAGAGGGCTGCTGGGTGGCCTACACGCTGGAGCAGCAGGAC
                    ************************************************************

HsCD00505665        GGGATGGACCGCTACCTCATCTATGTGGATGAGAGCCGAGAGTGTGTGGCAGGCCCCAAC
NM_000211.3         GGGATGGACCGCTACCTCATCTATGTGGATGAGAGCCGAGAGTGTGTGGCAGGCCCCAAC
NM_001127491.1      GGGATGGACCGCTACCTCATCTATGTGGATGAGAGCCGAGAGTGTGTGGCAGGCCCCAAC
                    ************************************************************

HsCD00505665        ATCGCCGCCATCGTCGGGGGCACCGTGGCAGGCATCGTGCTGATCGGCATTCTCCTGCTG
NM_000211.3         ATCGCCGCCATCGTCGGGGGCACCGTGGCAGGCATCGTGCTGATCGGCATTCTCCTGCTG
NM_001127491.1      ATCGCCGCCATCGTCGGGGGCACCGTGGCAGGCATCGTGCTGATCGGCATTCTCCTGCTG
                    ************************************************************

HsCD00505665        GTCATCTGGAAGGCTCTGATCCACCTGAGCGACCTCCGGGAGTACAGGCGCTTTGAGAAG
NM_000211.3         GTCATCTGGAAGGCTCTGATCCACCTGAGCGACCTCCGGGAGTACAGGCGCTTTGAGAAG
NM_001127491.1      GTCATCTGGAAGGCTCTGATCCACCTGAGCGACCTCCGGGAGTACAGGCGCTTTGAGAAG
                    ************************************************************

HsCD00505665        GAGAAGCTCAAGTCCCAGTGGAACAATGATAATCCCCTTTTCAAGAGCGCCACCACGACG
NM_000211.3         GAGAAGCTCAAGTCCCAGTGGAACAATGATAATCCCCTTTTCAAGAGCGCCACCACGACG
NM_001127491.1      GAGAAGCTCAAGTCCCAGTGGAACAATGATAATCCCCTTTTCAAGAGCGCCACCACGACG
                    ************************************************************

HsCD00505665        GTCATGAACCCCAAGTTTGCTGAGAGT---
NM_000211.3         GTCATGAACCCCAAGTTTGCTGAGAGTTAG
NM_001127491.1      GTCATGAACCCCAAGTTTGCTGAGAGTTAG
                    ***************************   

Pathways

NCI : amb2 Integrin signaling
NCI : Beta2 integrin cell surface interactions
NCI : CXCR3-mediated signaling events
NCI : HIF-1-alpha transcription factor network
NCI : Integrin family cell surface interactions
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
Panther : Integrin signalling pathway
Reactome : Adaptive Immune System
Reactome : Cell surface interactions at the vascular wall
Reactome : Extracellular matrix organization
Reactome : Hemostasis
Reactome : Immune System
Reactome : Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell
Reactome : Innate Immune System
Reactome : Integrin cell surface interactions
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : Focal Adhesion
WikiPathway : Integrin-mediated cell adhesion

Clone

Cloning Information : 614264
Original Clone ID : ccsbBroadEn_06464

Organism


TAX_ID : 9606
Species Specific ID: 3689

Genome

Chromosome : 21
Map Location : 21q22.3
Ensembl : ENSG00000160255

Reagents

Labome : CD18-antibody