DNASU Plasmid Repository • 480.965.5697 | Email

PIK3CB (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3CB
Gene Name:  phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
Sequence             
Original Clone ID: ccsbBroadEn_01202
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC114432.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00505993

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3211nts         Open reading frame : 1 to 3211
Reference Sequence Alignment

ATGTGCTTCAGTTTCATAATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCGGTG
GATTCACAGATAGCATCTGATGGCTCCATACCTGTGGATTTCCTTTTGCCCACTGGGATT
TATATCCAGTTGGAGGTACCTCGGGAAGCTACCATTTCTTATATTAAGCAGATGTTATGG
AAGCAAGTTCACAATTACCCAATGTTCAACCTCCTTATGGATATTGACTCCTATATGTTT
GCATGTGTGAATCAGACTGCTGTATATGAGGAGCTTGAAGATGAAACACGAAGACTCTGT
GATGTCAGACCTTTTCTTCCAGTTCTCAAATTAGTGACAAGAAGTTGTGACCCAGGGGAA
AAATTAGACTCAAAAATTGGAGTCCTTATAGGAAAAGGTCTGCATGAATTTGATTCCTTG
AAGGATCCTGAAGTAAATGAATTTCGAAGAAAAATGCGCAAATTCAGCGAGGAAAAAATC
CTGTCACTTGTGGGATTGTCTTGGATGGACTGGCTAAAACAAACATATCCACCAGAGCAT
GAACCATCCATCCCTGAAAACTTAGAAGATAAACTTTATGGGGGAAAGCTCATCGTAGCT
GTTCATTTTGAAAACTGCCAGGACGTGTTTAGCTTTCAAGTGTCTCCTAATATGAATCCT
ATCAAAGTAAATGAATTGGCAATCCAAAAACGTTTGACTATTCATGGGAAGGAAGATGAA
GTTAGCCCCTATGATTATGTGTTGCAAGTCAGCGGGAGAGTAGAATATGTTTTTGGTGAT
CATCCACTAATTCAGTTCCAGTATATCCGGAACTGTGTGATGAACAGAGCCCTGCCCCAT
TTTATACTTGTGGAATGCTGCAAGATCAAGAAAATGTATGAACAAGAAATGATTGCCATA
GAGGCTGCCATAAATCGAAATTCATCTAATCTTCCTCTTCCATTACCACCAAAGAAAACA
CGAATTATTTCTCATGTTTGGGAAAATAACAACCCTTTCCAAATTGTCTTGGTTAAGGGA
AATAAACTTAACACAGAGGAAACTGTAAAAGTTCATGTCAGGGCTGGTCTTTTTCATGGT
ACTGAGCTCCTGTGTAAAACCATCGTAAGCTCAGAGGTATCAGGGAAAAATGATCATATT
TGGAATGAACCACTGGAATTTGATATTAATATTTGTGACTTACCAAGAATGGCTCGATTA
TGTTTTGCTGTTTATGCAGTTTTGGATAAAGTAAAAACGAAGAAATCAACGAAAACTATT
AATCCCTCTAAATATCAGACCATCAGGAAAGCTGGAAAAGTGCATTATCCTGTAGCGTGG
GTAAATACGATGGTTTTTGACTTTAAAGGACAATTGAGAACTGGAGACATAATATTACAC
AGCTGGTCTTCATTTCCTGATGAACTCGAAGAAATGTTGAATCCAATGGGAACTGTTCAA
ACAAATCCATATACTGAAAATGCAACAGCTTTGCATGTTAAATTTCCAGAGAATAAAAAA
CAACCTTATTATTACCCTCCCTTCGATAAGATTATTGAAAAGGCAGCTGAGATTGCAAGC
AGTGATAGTGCTAATGTGTCAAGTCGAGGTGGAAAAAAGTTTCTTCCTGTATTGAAAGAA
ATCTTGGACAGGGATCCCTTGTCTCAACTGTGTGAAAATGAAATGGATCTTATTTGGACT
TTGCGACAAGACTGCCGAGAGATTTTCCCACAATCACTGCCAAAATTACTGCTGTCAATC
AAGTGGAATAAACTTGAGGATGTTGCTCAGCTTCAGGCGCTGCTTCAGATTTGGCCTAAA
CTGCCCCCCCGGGAGGCCCTAGAGCTTCTGGATTTCAACTATCCAGACCAGTACGTTCGA
GAATATGCTGTAGGCTGCCTGCGACAGATGAGTGATGAAGAACTTTCTCAATATCTTTTA
CAACTGGTGCAAGTGTTAAAATATGAGCCTTTTCTTGATTGTGCCCTCTCTAGATTCCTA
TTAGAAAGAGCACTTGGTAATCGGAGGATAGGGCAGTTTCTATTTTGGCATCTTAGGTCA
GAAGTGCACATTCCTGCTGTCTCAGTACAATTTGGTGTCATCCTTGAAGCATACTGCCGG
GGAAGTGTGGGGCACATGAAAGTGCTTTCTAAGCAGGTTGAAGCACTCAATAAGTTAAAA
ACTTTAAATAGTTTAATCAAACTGAATGCCGTGAAGTTAAACAGAGCCAAAGGGAAGGAG
GCCATGCATACCTGTTTAAAACAGAGTGCTTACCGGGAAGCCCTCTCTGACCTGCAGTCA
CCCCTGAACCCATGTGTTATCCTCTCAGAACTCTATGTTGAAAAGTGCAAATACATGGAT
TCCAAAATGAAGCCTTTGTGGCTGGTATACAATAACAAGGTATTTGGTGAGGATTCAGTT
GGAGTGATTTTTAAAAATGGTGATGATTTACGACAGGATATGTTGACACTCCAAATGTTG
CGCTTGATGGATTTACTCTGGAAAGAAGCTGGTTTGGATCTTCGGATGTTGCCTTATGGC
TGTTTAGCAACAGGAGATCGCTCTGGCCTCATTGAAGTTGTGAGCACCTCTGAAACAATT
GCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTGCAGCAGCCTTCAACAAAGATGCC
CTTCTGAACTGGCTTAAAGAATACAACTCTGGGGATGACCTGGACCGAGCCATTGAGGAA
TTTACACTGTCCTGTGCTGGCTACTGTGTAGCTTCTTATGTCCTTGGGATTGGTGACAGA
CATAGTGACAACATCATGGTCAAAAAAACTGGCCAGCTCTTCCACATTGACTTTGGACAT
ATTCTTGGAAATTTCAAATCTAAGTTTGGCATTAAAAGGGAGCGAGTGCCTTTTATTCTT
ACCTATGATTTCATCCATGTCATTCAACAAGGAAAAACAGGAAATACAGAAAAGTTTGGC
CGGTTCCGCCAGTGTTGTGAGGATGCATATCTGATTTTACGACGGCATGGGAATCTCTTC
ATCACTCTCTTTGCGCTGATGTTGACTGCAGGGCTTCCTGAACTCACATCAGTCAAAGAT
ATACAGTATCTTAAGGACTCTCTTGCATTAGGGAAGAGTGAAGAAGAAGCACTCAAACAG
TTTAAGCAAAAATTTGATGAGGCGCTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATG
GCCCACACAGTTCGGAAAGACTACAGATCT


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PIK3CB
Symbol Nomenclature : PIK3CB
SYNONYM : P110BETA; PI3K; PI3KBETA; PIK3C1
Designation : PI3-kinase p110 subunit beta|PI3-kinase subunit beta|PI3K-beta|PtdIns-3-kinase p110|phosphatidylinositol 4,5-bisphosphate 3-kinase 110 kDa catalytic subunit beta|phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit beta isoform|phosphatidylinositol-4,5-bisphosphate 3-kinase 110 kDa catalytic subunit beta|phosphoinositide-3-kinase, catalytic, beta polypeptide|ptdIns-3-kinase subunit beta|ptdIns-3-kinase subunit p110-beta
Full Nomenclature : phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
GENEID : 5291
HGNC : 8976
MIM : 602925
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00505993        ATGTGCTTCAGTTTCATAATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCGGTG
XM_005247532.1      ATGTGCTTCAGTTTCATAATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCGGTG
XM_005247530.1      ATGTGCTTCAGTTTCATAATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCGGTG
NM_006219.2         ATGTGCTTCAGTTTCATAATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCGGTG
XM_005247531.1      ATGTGCTTCAGTTTCATAATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCGGTG
                    ************************************************************

HsCD00505993        GATTCACAGATAGCATCTGATGGCTCCATACCTGTGGATTTCCTTTTGCCCACTGGGATT
XM_005247532.1      GATTCACAGATAGCATCTGATGGCTCCATACCTGTGGATTTCCTTTTGCCCACTGGGATT
XM_005247530.1      GATTCACAGATAGCATCTGATGGCTCCATACCTGTGGATTTCCTTTTGCCCACTGGGATT
NM_006219.2         GATTCACAGATAGCATCTGATGGCTCCATACCTGTGGATTTCCTTTTGCCCACTGGGATT
XM_005247531.1      GATTCACAGATAGCATCTGATGGCTCCATACCTGTGGATTTCCTTTTGCCCACTGGGATT
                    ************************************************************

HsCD00505993        TATATCCAGTTGGAGGTACCTCGGGAAGCTACCATTTCTTATATTAAGCAGATGTTATGG
XM_005247532.1      TATATCCAGTTGGAGGTACCTCGGGAAGCTACCATTTCTTATATTAAGCAGATGTTATGG
XM_005247530.1      TATATCCAGTTGGAGGTACCTCGGGAAGCTACCATTTCTTATATTAAGCAGATGTTATGG
NM_006219.2         TATATCCAGTTGGAGGTACCTCGGGAAGCTACCATTTCTTATATTAAGCAGATGTTATGG
XM_005247531.1      TATATCCAGTTGGAGGTACCTCGGGAAGCTACCATTTCTTATATTAAGCAGATGTTATGG
                    ************************************************************

HsCD00505993        AAGCAAGTTCACAATTACCCAATGTTCAACCTCCTTATGGATATTGACTCCTATATGTTT
XM_005247532.1      AAGCAAGTTCACAATTACCCAATGTTCAACCTCCTTATGGATATTGACTCCTATATGTTT
XM_005247530.1      AAGCAAGTTCACAATTACCCAATGTTCAACCTCCTTATGGATATTGACTCCTATATGTTT
NM_006219.2         AAGCAAGTTCACAATTACCCAATGTTCAACCTCCTTATGGATATTGACTCCTATATGTTT
XM_005247531.1      AAGCAAGTTCACAATTACCCAATGTTCAACCTCCTTATGGATATTGACTCCTATATGTTT
                    ************************************************************

HsCD00505993        GCATGTGTGAATCAGACTGCTGTATATGAGGAGCTTGAAGATGAAACACGAAGACTCTGT
XM_005247532.1      GCATGTGTGAATCAGACTGCTGTATATGAGGAGCTTGAAGATGAAACACGAAGACTCTGT
XM_005247530.1      GCATGTGTGAATCAGACTGCTGTATATGAGGAGCTTGAAGATGAAACACGAAGACTCTGT
NM_006219.2         GCATGTGTGAATCAGACTGCTGTATATGAGGAGCTTGAAGATGAAACACGAAGACTCTGT
XM_005247531.1      GCATGTGTGAATCAGACTGCTGTATATGAGGAGCTTGAAGATGAAACACGAAGACTCTGT
                    ************************************************************

HsCD00505993        GATGTCAGACCTTTTCTTCCAGTTCTCAAATTAGTGACAAGAAGTTGTGACCCAGGGGAA
XM_005247532.1      GATGTCAGACCTTTTCTTCCAGTTCTCAAATTAGTGACAAGAAGTTGTGACCCAGGGGAA
XM_005247530.1      GATGTCAGACCTTTTCTTCCAGTTCTCAAATTAGTGACAAGAAGTTGTGACCCAGGGGAA
NM_006219.2         GATGTCAGACCTTTTCTTCCAGTTCTCAAATTAGTGACAAGAAGTTGTGACCCAGGGGAA
XM_005247531.1      GATGTCAGACCTTTTCTTCCAGTTCTCAAATTAGTGACAAGAAGTTGTGACCCAGGGGAA
                    ************************************************************

HsCD00505993        AAATTAGACTCAAAAATTGGAGTCCTTATAGGAAAAGGTCTGCATGAATTTGATTCCTTG
XM_005247532.1      AAATTAGACTCAAAAATTGGAGTCCTTATAGGAAAAGGTCTGCATGAATTTGATTCCTTG
XM_005247530.1      AAATTAGACTCAAAAATTGGAGTCCTTATAGGAAAAGGTCTGCATGAATTTGATTCCTTG
NM_006219.2         AAATTAGACTCAAAAATTGGAGTCCTTATAGGAAAAGGTCTGCATGAATTTGATTCCTTG
XM_005247531.1      AAATTAGACTCAAAAATTGGAGTCCTTATAGGAAAAGGTCTGCATGAATTTGATTCCTTG
                    ************************************************************

HsCD00505993        AAGGATCCTGAAGTAAATGAATTTCGAAGAAAAATGCGCAAATTCAGCGAGGAAAAAATC
XM_005247532.1      AAGGATCCTGAAGTAAATGAATTTCGAAGAAAAATGCGCAAATTCAGCGAGGAAAAAATC
XM_005247530.1      AAGGATCCTGAAGTAAATGAATTTCGAAGAAAAATGCGCAAATTCAGCGAGGAAAAAATC
NM_006219.2         AAGGATCCTGAAGTAAATGAATTTCGAAGAAAAATGCGCAAATTCAGCGAGGAAAAAATC
XM_005247531.1      AAGGATCCTGAAGTAAATGAATTTCGAAGAAAAATGCGCAAATTCAGCGAGGAAAAAATC
                    ************************************************************

HsCD00505993        CTGTCACTTGTGGGATTGTCTTGGATGGACTGGCTAAAACAAACATATCCACCAGAGCAT
XM_005247532.1      CTGTCACTTGTGGGATTGTCTTGGATGGACTGGCTAAAACAAACATATCCACCAGAGCAT
XM_005247530.1      CTGTCACTTGTGGGATTGTCTTGGATGGACTGGCTAAAACAAACATATCCACCAGAGCAT
NM_006219.2         CTGTCACTTGTGGGATTGTCTTGGATGGACTGGCTAAAACAAACATATCCACCAGAGCAT
XM_005247531.1      CTGTCACTTGTGGGATTGTCTTGGATGGACTGGCTAAAACAAACATATCCACCAGAGCAT
                    ************************************************************

HsCD00505993        GAACCATCCATCCCTGAAAACTTAGAAGATAAACTTTATGGGGGAAAGCTCATCGTAGCT
XM_005247532.1      GAACCATCCATCCCTGAAAACTTAGAAGATAAACTTTATGGGGGAAAGCTCATCGTAGCT
XM_005247530.1      GAACCATCCATCCCTGAAAACTTAGAAGATAAACTTTATGGGGGAAAGCTCATCGTAGCT
NM_006219.2         GAACCATCCATCCCTGAAAACTTAGAAGATAAACTTTATGGGGGAAAGCTCATCGTAGCT
XM_005247531.1      GAACCATCCATCCCTGAAAACTTAGAAGATAAACTTTATGGGGGAAAGCTCATCGTAGCT
                    ************************************************************

HsCD00505993        GTTCATTTTGAAAACTGCCAGGACGTGTTTAGCTTTCAAGTGTCTCCTAATATGAATCCT
XM_005247532.1      GTTCATTTTGAAAACTGCCAGGACGTGTTTAGCTTTCAAGTGTCTCCTAATATGAATCCT
XM_005247530.1      GTTCATTTTGAAAACTGCCAGGACGTGTTTAGCTTTCAAGTGTCTCCTAATATGAATCCT
NM_006219.2         GTTCATTTTGAAAACTGCCAGGACGTGTTTAGCTTTCAAGTGTCTCCTAATATGAATCCT
XM_005247531.1      GTTCATTTTGAAAACTGCCAGGACGTGTTTAGCTTTCAAGTGTCTCCTAATATGAATCCT
                    ************************************************************

HsCD00505993        ATCAAAGTAAATGAATTGGCAATCCAAAAACGTTTGACTATTCATGGGAAGGAAGATGAA
XM_005247532.1      ATCAAAGTAAATGAATTGGCAATCCAAAAACGTTTGACTATTCATGGGAAGGAAGATGAA
XM_005247530.1      ATCAAAGTAAATGAATTGGCAATCCAAAAACGTTTGACTATTCATGGGAAGGAAGATGAA
NM_006219.2         ATCAAAGTAAATGAATTGGCAATCCAAAAACGTTTGACTATTCATGGGAAGGAAGATGAA
XM_005247531.1      ATCAAAGTAAATGAATTGGCAATCCAAAAACGTTTGACTATTCATGGGAAGGAAGATGAA
                    ************************************************************

HsCD00505993        GTTAGCCCCTATGATTATGTGTTGCAAGTCAGCGGGAGAGTAGAATATGTTTTTGGTGAT
XM_005247532.1      GTTAGCCCCTATGATTATGTGTTGCAAGTCAGCGGGAGAGTAGAATATGTTTTTGGTGAT
XM_005247530.1      GTTAGCCCCTATGATTATGTGTTGCAAGTCAGCGGGAGAGTAGAATATGTTTTTGGTGAT
NM_006219.2         GTTAGCCCCTATGATTATGTGTTGCAAGTCAGCGGGAGAGTAGAATATGTTTTTGGTGAT
XM_005247531.1      GTTAGCCCCTATGATTATGTGTTGCAAGTCAGCGGGAGAGTAGAATATGTTTTTGGTGAT
                    ************************************************************

HsCD00505993        CATCCACTAATTCAGTTCCAGTATATCCGGAACTGTGTGATGAACAGAGCCCTGCCCCAT
XM_005247532.1      CATCCACTAATTCAGTTCCAGTATATCCGGAACTGTGTGATGAACAGAGCCCTGCCCCAT
XM_005247530.1      CATCCACTAATTCAGTTCCAGTATATCCGGAACTGTGTGATGAACAGAGCCCTGCCCCAT
NM_006219.2         CATCCACTAATTCAGTTCCAGTATATCCGGAACTGTGTGATGAACAGAGCCCTGCCCCAT
XM_005247531.1      CATCCACTAATTCAGTTCCAGTATATCCGGAACTGTGTGATGAACAGAGCCCTGCCCCAT
                    ************************************************************

HsCD00505993        TTTATACTTGTGGAATGCTGCAAGATCAAGAAAATGTATGAACAAGAAATGATTGCCATA
XM_005247532.1      TTTATACTTGTGGAATGCTGCAAGATCAAGAAAATGTATGAACAAGAAATGATTGCCATA
XM_005247530.1      TTTATACTTGTGGAATGCTGCAAGATCAAGAAAATGTATGAACAAGAAATGATTGCCATA
NM_006219.2         TTTATACTTGTGGAATGCTGCAAGATCAAGAAAATGTATGAACAAGAAATGATTGCCATA
XM_005247531.1      TTTATACTTGTGGAATGCTGCAAGATCAAGAAAATGTATGAACAAGAAATGATTGCCATA
                    ************************************************************

HsCD00505993        GAGGCTGCCATAAATCGAAATTCATCTAATCTTCCTCTTCCATTACCACCAAAGAAAACA
XM_005247532.1      GAGGCTGCCATAAATCGAAATTCATCTAATCTTCCTCTTCCATTACCACCAAAGAAAACA
XM_005247530.1      GAGGCTGCCATAAATCGAAATTCATCTAATCTTCCTCTTCCATTACCACCAAAGAAAACA
NM_006219.2         GAGGCTGCCATAAATCGAAATTCATCTAATCTTCCTCTTCCATTACCACCAAAGAAAACA
XM_005247531.1      GAGGCTGCCATAAATCGAAATTCATCTAATCTTCCTCTTCCATTACCACCAAAGAAAACA
                    ************************************************************

HsCD00505993        CGAATTATTTCTCATGTTTGGGAAAATAACAACCCTTTCCAAATTGTCTTGGTTAAGGGA
XM_005247532.1      CGAATTATTTCTCATGTTTGGGAAAATAACAACCCTTTCCAAATTGTCTTGGTTAAGGGA
XM_005247530.1      CGAATTATTTCTCATGTTTGGGAAAATAACAACCCTTTCCAAATTGTCTTGGTTAAGGGA
NM_006219.2         CGAATTATTTCTCATGTTTGGGAAAATAACAACCCTTTCCAAATTGTCTTGGTTAAGGGA
XM_005247531.1      CGAATTATTTCTCATGTTTGGGAAAATAACAACCCTTTCCAAATTGTCTTGGTTAAGGGA
                    ************************************************************

HsCD00505993        AATAAACTTAACACAGAGGAAACTGTAAAAGTTCATGTCAGGGCTGGTCTTTTTCATGGT
XM_005247532.1      AATAAACTTAACACAGAGGAAACTGTAAAAGTTCATGTCAGGGCTGGTCTTTTTCATGGT
XM_005247530.1      AATAAACTTAACACAGAGGAAACTGTAAAAGTTCATGTCAGGGCTGGTCTTTTTCATGGT
NM_006219.2         AATAAACTTAACACAGAGGAAACTGTAAAAGTTCATGTCAGGGCTGGTCTTTTTCATGGT
XM_005247531.1      AATAAACTTAACACAGAGGAAACTGTAAAAGTTCATGTCAGGGCTGGTCTTTTTCATGGT
                    ************************************************************

HsCD00505993        ACTGAGCTCCTGTGTAAAACCATCGTAAGCTCAGAGGTATCAGGGAAAAATGATCATATT
XM_005247532.1      ACTGAGCTCCTGTGTAAAACCATCGTAAGCTCAGAGGTATCAGGGAAAAATGATCATATT
XM_005247530.1      ACTGAGCTCCTGTGTAAAACCATCGTAAGCTCAGAGGTATCAGGGAAAAATGATCATATT
NM_006219.2         ACTGAGCTCCTGTGTAAAACCATCGTAAGCTCAGAGGTATCAGGGAAAAATGATCATATT
XM_005247531.1      ACTGAGCTCCTGTGTAAAACCATCGTAAGCTCAGAGGTATCAGGGAAAAATGATCATATT
                    ************************************************************

HsCD00505993        TGGAATGAACCACTGGAATTTGATATTAATATTTGTGACTTACCAAGAATGGCTCGATTA
XM_005247532.1      TGGAATGAACCACTGGAATTTGATATTAATATTTGTGACTTACCAAGAATGGCTCGATTA
XM_005247530.1      TGGAATGAACCACTGGAATTTGATATTAATATTTGTGACTTACCAAGAATGGCTCGATTA
NM_006219.2         TGGAATGAACCACTGGAATTTGATATTAATATTTGTGACTTACCAAGAATGGCTCGATTA
XM_005247531.1      TGGAATGAACCACTGGAATTTGATATTAATATTTGTGACTTACCAAGAATGGCTCGATTA
                    ************************************************************

HsCD00505993        TGTTTTGCTGTTTATGCAGTTTTGGATAAAGTAAAAACGAAGAAATCAACGAAAACTATT
XM_005247532.1      TGTTTTGCTGTTTATGCAGTTTTGGATAAAGTAAAAACGAAGAAATCAACGAAAACTATT
XM_005247530.1      TGTTTTGCTGTTTATGCAGTTTTGGATAAAGTAAAAACGAAGAAATCAACGAAAACTATT
NM_006219.2         TGTTTTGCTGTTTATGCAGTTTTGGATAAAGTAAAAACGAAGAAATCAACGAAAACTATT
XM_005247531.1      TGTTTTGCTGTTTATGCAGTTTTGGATAAAGTAAAAACGAAGAAATCAACGAAAACTATT
                    ************************************************************

HsCD00505993        AATCCCTCTAAATATCAGACCATCAGGAAAGCTGGAAAAGTGCATTATCCTGTAGCGTGG
XM_005247532.1      AATCCCTCTAAATATCAGACCATCAGGAAAGCTGGAAAAGTGCATTATCCTGTAGCGTGG
XM_005247530.1      AATCCCTCTAAATATCAGACCATCAGGAAAGCTGGAAAAGTGCATTATCCTGTAGCGTGG
NM_006219.2         AATCCCTCTAAATATCAGACCATCAGGAAAGCTGGAAAAGTGCATTATCCTGTAGCGTGG
XM_005247531.1      AATCCCTCTAAATATCAGACCATCAGGAAAGCTGGAAAAGTGCATTATCCTGTAGCGTGG
                    ************************************************************

HsCD00505993        GTAAATACGATGGTTTTTGACTTTAAAGGACAATTGAGAACTGGAGACATAATATTACAC
XM_005247532.1      GTAAATACGATGGTTTTTGACTTTAAAGGACAATTGAGAACTGGAGACATAATATTACAC
XM_005247530.1      GTAAATACGATGGTTTTTGACTTTAAAGGACAATTGAGAACTGGAGACATAATATTACAC
NM_006219.2         GTAAATACGATGGTTTTTGACTTTAAAGGACAATTGAGAACTGGAGACATAATATTACAC
XM_005247531.1      GTAAATACGATGGTTTTTGACTTTAAAGGACAATTGAGAACTGGAGACATAATATTACAC
                    ************************************************************

HsCD00505993        AGCTGGTCTTCATTTCCTGATGAACTCGAAGAAATGTTGAATCCAATGGGAACTGTTCAA
XM_005247532.1      AGCTGGTCTTCATTTCCTGATGAACTCGAAGAAATGTTGAATCCAATGGGAACTGTTCAA
XM_005247530.1      AGCTGGTCTTCATTTCCTGATGAACTCGAAGAAATGTTGAATCCAATGGGAACTGTTCAA
NM_006219.2         AGCTGGTCTTCATTTCCTGATGAACTCGAAGAAATGTTGAATCCAATGGGAACTGTTCAA
XM_005247531.1      AGCTGGTCTTCATTTCCTGATGAACTCGAAGAAATGTTGAATCCAATGGGAACTGTTCAA
                    ************************************************************

HsCD00505993        ACAAATCCATATACTGAAAATGCAACAGCTTTGCATGTTAAATTTCCAGAGAATAAAAAA
XM_005247532.1      ACAAATCCATATACTGAAAATGCAACAGCTTTGCATGTTAAATTTCCAGAGAATAAAAAA
XM_005247530.1      ACAAATCCATATACTGAAAATGCAACAGCTTTGCATGTTAAATTTCCAGAGAATAAAAAA
NM_006219.2         ACAAATCCATATACTGAAAATGCAACAGCTTTGCATGTTAAATTTCCAGAGAATAAAAAA
XM_005247531.1      ACAAATCCATATACTGAAAATGCAACAGCTTTGCATGTTAAATTTCCAGAGAATAAAAAA
                    ************************************************************

HsCD00505993        CAACCTTATTATTACCCTCCCTTCGATAAGATTATTGAAAAGGCAGCTGAGATTGCAAGC
XM_005247532.1      CAACCTTATTATTACCCTCCCTTCGATAAGAG----------------------------
XM_005247530.1      CAACCTTATTATTACCCTCCCTTCGATAAGATTATTGAAAAGGCAGCTGAGATTGCAAGC
NM_006219.2         CAACCTTATTATTACCCTCCCTTCGATAAGATTATTGAAAAGGCAGCTGAGATTGCAAGC
XM_005247531.1      CAACCTTATTATTACCCTCCCTTCGATAAGATTATTGAAAAGGCAGCTGAGATTGCAAGC
                    *******************************                             

HsCD00505993        AGTGATAGTGCTAATGTGTCAAGTCGAGGTGGAAAAAAGTTTCTTCCTGTATTGAAAGAA
XM_005247532.1      -----------------------TCGAGGTGGAAAAAAGTTTCTTCCTGTATTGAAAGAA
XM_005247530.1      AGTGATAGTGCTAATGTGTCAAGTCGAGGTGGAAAAAAGTTTCTTCCTGTATTGAAAGAA
NM_006219.2         AGTGATAGTGCTAATGTGTCAAGTCGAGGTGGAAAAAAGTTTCTTCCTGTATTGAAAGAA
XM_005247531.1      AGTGATAGTGCTAATGTGTCAAGTCGAGGTGGAAAAAAGTTTCTTCCTGTATTGAAAGAA
                                           *************************************

HsCD00505993        ATCTTGGACAGGGATCCCTTGTCTCAACTGTGTGAAAATGAAATGGATCTTATTTGGACT
XM_005247532.1      ATCTTGGACAGGGATCCCTTGTCTCAACTGTGTGAAAATGAAATGGATCTTATTTGGACT
XM_005247530.1      ATCTTGGACAGGGATCCCTTGTCTCAACTGTGTGAAAATGAAATGGATCTTATTTGGACT
NM_006219.2         ATCTTGGACAGGGATCCCTTGTCTCAACTGTGTGAAAATGAAATGGATCTTATTTGGACT
XM_005247531.1      ATCTTGGACAGGGATCCCTTGTCTCAACTGTGTGAAAATGAAATGGATCTTATTTGGACT
                    ************************************************************

HsCD00505993        TTGCGACAAGACTGCCGAGAGATTTTCCCACAATCACTGCCAAAATTACTGCTGTCAATC
XM_005247532.1      TTGCGACAAGACTGCCGAGAGATTTTCCCACAATCACTGCCAAAATTACTGCTGTCAATC
XM_005247530.1      TTGCGACAAGACTGCCGAGAGATTTTCCCACAATCACTGCCAAAATTACTGCTGTCAATC
NM_006219.2         TTGCGACAAGACTGCCGAGAGATTTTCCCACAATCACTGCCAAAATTACTGCTGTCAATC
XM_005247531.1      TTGCGACAAGACTGCCGAGAGATTTTCCCACAATCACTGCCAAAATTACTGCTGTCAATC
                    ************************************************************

HsCD00505993        AAGTGGAATAAACTTGAGGATGTTGCTCAGCTTCAGGCGCTGCTTCAGATTTGGCCTAAA
XM_005247532.1      AAGTGGAATAAACTTGAGGATGTTGCTCAGCTTCAGGCGCTGCTTCAGATTTGGCCTAAA
XM_005247530.1      AAGTGGAATAAACTTGAGGATGTTGCTCAGCTTCAGGCGCTGCTTCAGATTTGGCCTAAA
NM_006219.2         AAGTGGAATAAACTTGAGGATGTTGCTCAGCTTCAGGCGCTGCTTCAGATTTGGCCTAAA
XM_005247531.1      AAGTGGAATAAACTTGAGGATGTTGCTCAGCTTCAGGCGCTGCTTCAGATTTGGCCTAAA
                    ************************************************************

HsCD00505993        CTGCCCCCCCGGGAGGCCCTAGAGCTTCTGGATTTCAACTATCCAGACCAGTACGTTCGA
XM_005247532.1      CTGCCCCCCCGGGAGGCCCTAGAGCTTCTGGATTTCAACTATCCAGACCAGTACGTTCGA
XM_005247530.1      CTGCCCCCCCGGGAGGCCCTAGAGCTTCTGGATTTCAACTATCCAGACCAGTACGTTCGA
NM_006219.2         CTGCCCCCCCGGGAGGCCCTAGAGCTTCTGGATTTCAACTATCCAGACCAGTACGTTCGA
XM_005247531.1      CTGCCCCCCCGGGAGGCCCTAGAGCTTCTGGATTTCAACTATCCAGACCAGTACGTTCGA
                    ************************************************************

HsCD00505993        GAATATGCTGTAGGCTGCCTGCGACAGATGAGTGATGAAGAACTTTCTCAATATCTTTTA
XM_005247532.1      GAATATGCTGTAGGCTGCCTGCGACAGATGAGTGATGAAGAACTTTCTCAATATCTTTTA
XM_005247530.1      GAATATGCTGTAGGCTGCCTGCGACAGATGAGTGATGAAGAACTTTCTCAATATCTTTTA
NM_006219.2         GAATATGCTGTAGGCTGCCTGCGACAGATGAGTGATGAAGAACTTTCTCAATATCTTTTA
XM_005247531.1      GAATATGCTGTAGGCTGCCTGCGACAGATGAGTGATGAAGAACTTTCTCAATATCTTTTA
                    ************************************************************

HsCD00505993        CAACTGGTGCAAGTGTTAAAATATGAGCCTTTTCTTGATTGTGCCCTCTCTAGATTCCTA
XM_005247532.1      CAACTGGTGCAAGTGTTAAAATATGAGCCTTTTCTTGATTGTGCCCTCTCTAGATTCCTA
XM_005247530.1      CAACTGGTGCAAGTGTTAAAATATGAGCCTTTTCTTGATTGTGCCCTCTCTAGATTCCTA
NM_006219.2         CAACTGGTGCAAGTGTTAAAATATGAGCCTTTTCTTGATTGTGCCCTCTCTAGATTCCTA
XM_005247531.1      CAACTGGTGCAAGTGTTAAAATATGAGCCTTTTCTTGATTGTGCCCTCTCTAGATTCCTA
                    ************************************************************

HsCD00505993        TTAGAAAGAGCACTTGGTAATCGGAGGATAGGGCAGTTTCTATTTTGGCATCTTAGGTCA
XM_005247532.1      TTAGAAAGAGCACTTGGTAATCGGAGGATAGGGCAGTTTCTATTTTGGCATCTTAGGTCA
XM_005247530.1      TTAGAAAGAGCACTTGGTAATCGGAGGATAGGGCAGTTTCTATTTTGGCATCTTAGGTCA
NM_006219.2         TTAGAAAGAGCACTTGGTAATCGGAGGATAGGGCAGTTTCTATTTTGGCATCTTAGGTCA
XM_005247531.1      TTAGAAAGAGCACTTGGTAATCGGAGGATAGGGCAGTTTCTATTTTGGCATCTTAGGTCA
                    ************************************************************

HsCD00505993        GAAGTGCACATTCCTGCTGTCTCAGTACAATTTGGTGTCATCCTTGAAGCATACTGCCGG
XM_005247532.1      GAAGTGCACATTCCTGCTGTCTCAGTACAATTTGGTGTCATCCTTGAAGCATACTGCCGG
XM_005247530.1      GAAGTGCACATTCCTGCTGTCTCAGTACAATTTGGTGTCATCCTTGAAGCATACTGCCGG
NM_006219.2         GAAGTGCACATTCCTGCTGTCTCAGTACAATTTGGTGTCATCCTTGAAGCATACTGCCGG
XM_005247531.1      GAAGTGCACATTCCTGCTGTCTCAGTACAATTTGGTGTCATCCTTGAAGCATACTGCCGG
                    ************************************************************

HsCD00505993        GGAAGTGTGGGGCACATGAAAGTGCTTTCTAAGCAGGTTGAAGCACTCAATAAGTTAAAA
XM_005247532.1      GGAAGTGTGGGGCACATGAAAGTGCTTTCTAAGCAGGTTGAAGCACTCAATAAGTTAAAA
XM_005247530.1      GGAAGTGTGGGGCACATGAAAGTGCTTTCTAAGCAGGTTGAAGCACTCAATAAGTTAAAA
NM_006219.2         GGAAGTGTGGGGCACATGAAAGTGCTTTCTAAGCAGGTTGAAGCACTCAATAAGTTAAAA
XM_005247531.1      GGAAGTGTGGGGCACATGAAAGTGCTTTCTAAGCAGGTTGAAGCACTCAATAAGTTAAAA
                    ************************************************************

HsCD00505993        ACTTTAAATAGTTTAATCAAACTGAATGCCGTGAAGTTAAACAGAGCCAAAGGGAAGGAG
XM_005247532.1      ACTTTAAATAGTTTAATCAAACTGAATGCCGTGAAGTTAAACAGAGCCAAAGGGAAGGAG
XM_005247530.1      ACTTTAAATAGTTTAATCAAACTGAATGCCGTGAAGTTAAACAGAGCCAAAGGGAAGGAG
NM_006219.2         ACTTTAAATAGTTTAATCAAACTGAATGCCGTGAAGTTAAACAGAGCCAAAGGGAAGGAG
XM_005247531.1      ACTTTAAATAGTTTAATCAAACTGAATGCCGTGAAGTTAAACAGAGCCAAAGGGAAGGAG
                    ************************************************************

HsCD00505993        GCCATGCATACCTGTTTAAAACAGAGTGCTTACCGGGAAGCCCTCTCTGACCTGCAGTCA
XM_005247532.1      GCCATGCATACCTGTTTAAAACAGAGTGCTTACCGGGAAGCCCTCTCTGACCTGCAGTCA
XM_005247530.1      GCCATGCATACCTGTTTAAAACAGAGTGCTTACCGGGAAGCCCTCTCTGACCTGCAGTCA
NM_006219.2         GCCATGCATACCTGTTTAAAACAGAGTGCTTACCGGGAAGCCCTCTCTGACCTGCAGTCA
XM_005247531.1      GCCATGCATACCTGTTTAAAACAGAGTGCTTACCGGGAAGCCCTCTCTGACCTGCAGTCA
                    ************************************************************

HsCD00505993        CCCCTGAACCCATGTGTTATCCTCTCAGAACTCTATGTTGAAAAGTGCAAATACATGGAT
XM_005247532.1      CCCCTGAACCCATGTGTTATCCTCTCAGAACTCTATGTTGAAAAGTGCAAATACATGGAT
XM_005247530.1      CCCCTGAACCCATGTGTTATCCTCTCAGAACTCTATGTTGAAAAGTGCAAATACATGGAT
NM_006219.2         CCCCTGAACCCATGTGTTATCCTCTCAGAACTCTATGTTGAAAAGTGCAAATACATGGAT
XM_005247531.1      CCCCTGAACCCATGTGTTATCCTCTCAGAACTCTATGTTGAAAAGTGCAAATACATGGAT
                    ************************************************************

HsCD00505993        TCCAAAATGAAGCCTTTGTGGCTGGTATACAATAACAAGGTATTTGGTGAGGATTCAGTT
XM_005247532.1      TCCAAAATGAAGCCTTTGTGGCTGGTATACAATAACAAGGTATTTGGTGAGGATTCAGTT
XM_005247530.1      TCCAAAATGAAGCCTTTGTGGCTGGTATACAATAACAAGGTATTTGGTGAGGATTCAGTT
NM_006219.2         TCCAAAATGAAGCCTTTGTGGCTGGTATACAATAACAAGGTATTTGGTGAGGATTCAGTT
XM_005247531.1      TCCAAAATGAAGCCTTTGTGGCTGGTATACAATAACAAGGTATTTGGTGAGGATTCAGTT
                    ************************************************************

HsCD00505993        GGAGTGATTTTTAAAAATGGTGATGATTTACGACAGGATATGTTGACACTCCAAATGTTG
XM_005247532.1      GGAGTGATTTTTAAAAATGGTGATGATTTACGACAGGATATGTTGACACTCCAAATGTTG
XM_005247530.1      GGAGTGATTTTTAAAAATGGTGATGATTTACGACAGGATATGTTGACACTCCAAATGTTG
NM_006219.2         GGAGTGATTTTTAAAAATGGTGATGATTTACGACAGGATATGTTGACACTCCAAATGTTG
XM_005247531.1      GGAGTGATTTTTAAAAATGGTGATGATTTACGACAGGATATGTTGACACTCCAAATGTTG
                    ************************************************************

HsCD00505993        CGCTTGATGGATTTACTCTGGAAAGAAGCTGGTTTGGATCTTCGGATGTTGCCTTATGGC
XM_005247532.1      CGCTTGATGGATTTACTCTGGAAAGAAGCTGGTTTGGATCTTCGGATGTTGCCTTATGGC
XM_005247530.1      CGCTTGATGGATTTACTCTGGAAAGAAGCTGGTTTGGATCTTCGGATGTTGCCTTATGGC
NM_006219.2         CGCTTGATGGATTTACTCTGGAAAGAAGCTGGTTTGGATCTTCGGATGTTGCCTTATGGC
XM_005247531.1      CGCTTGATGGATTTACTCTGGAAAGAAGCTGGTTTGGATCTTCGGATGTTGCCTTATGGC
                    ************************************************************

HsCD00505993        TGTTTAGCAACAGGAGATCGCTCTGGCCTCATTGAAGTTGTGAGCACCTCTGAAACAATT
XM_005247532.1      TGTTTAGCAACAGGAGATCGCTCTGGCCTCATTGAAGTTGTGAGCACCTCTGAAACAATT
XM_005247530.1      TGTTTAGCAACAGGAGATCGCTCTGGCCTCATTGAAGTTGTGAGCACCTCTGAAACAATT
NM_006219.2         TGTTTAGCAACAGGAGATCGCTCTGGCCTCATTGAAGTTGTGAGCACCTCTGAAACAATT
XM_005247531.1      TGTTTAGCAACAGGAGATCGCTCTGGCCTCATTGAAGTTGTGAGCACCTCTGAAACAATT
                    ************************************************************

HsCD00505993        GCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTGCAGCAGCCTTCAACAAAGATGCC
XM_005247532.1      GCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTGCAGCAGCCTTCAACAAAGATGCC
XM_005247530.1      GCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTGCAGCAGCCTTCAACAAAGATGCC
NM_006219.2         GCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTGCAGCAGCCTTCAACAAAGATGCC
XM_005247531.1      GCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTGCAGCAGCCTTCAACAAAGATGCC
                    ************************************************************

HsCD00505993        CTTCTGAACTGGCTTAAAGAATACAACTCTGGGGATGACCTGGACCGAGCCATTGAGGAA
XM_005247532.1      CTTCTGAACTGGCTTAAAGAATACAACTCTGGGGATGACCTGGACCGAGCCATTGAGGAA
XM_005247530.1      CTTCTGAACTGGCTTAAAGAATACAACTCTGGGGATGACCTGGACCGAGCCATTGAGGAA
NM_006219.2         CTTCTGAACTGGCTTAAAGAATACAACTCTGGGGATGACCTGGACCGAGCCATTGAGGAA
XM_005247531.1      CTTCTGAACTGGCTTAAAGAATACAACTCTGGGGATGACCTGGACCGAGCCATTGAGGAA
                    ************************************************************

HsCD00505993        TTTACACTGTCCTGTGCTGGCTACTGTGTAGCTTCTTATGTCCTTGGGATTGGTGACAGA
XM_005247532.1      TTTACACTGTCCTGTGCTGGCTACTGTGTAGCTTCTTATGTCCTTGGGATTGGTGACAGA
XM_005247530.1      TTTACACTGTCCTGTGCTGGCTACTGTGTAGCTTCTTATGTCCTTGGGATTGGTGACAGA
NM_006219.2         TTTACACTGTCCTGTGCTGGCTACTGTGTAGCTTCTTATGTCCTTGGGATTGGTGACAGA
XM_005247531.1      TTTACACTGTCCTGTGCTGGCTACTGTGTAGCTTCTTATGTCCTTGGGATTGGTGACAGA
                    ************************************************************

HsCD00505993        CATAGTGACAACATCATGGTCAAAAAAACTGGCCAGCTCTTCCACATTGACTTTGGACAT
XM_005247532.1      CATAGTGACAACATCATGGTCAAAAAAACTGGCCAGCTCTTCCACATTGACTTTGGACAT
XM_005247530.1      CATAGTGACAACATCATGGTCAAAAAAACTGGCCAGCTCTTCCACATTGACTTTGGACAT
NM_006219.2         CATAGTGACAACATCATGGTCAAAAAAACTGGCCAGCTCTTCCACATTGACTTTGGACAT
XM_005247531.1      CATAGTGACAACATCATGGTCAAAAAAACTGGCCAGCTCTTCCACATTGACTTTGGACAT
                    ************************************************************

HsCD00505993        ATTCTTGGAAATTTCAAATCTAAGTTTGGCATTAAAAGGGAGCGAGTGCCTTTTATTCTT
XM_005247532.1      ATTCTTGGAAATTTCAAATCTAAGTTTGGCATTAAAAGGGAGCGAGTGCCTTTTATTCTT
XM_005247530.1      ATTCTTGGAAATTTCAAATCTAAGTTTGGCATTAAAAGGGAGCGAGTGCCTTTTATTCTT
NM_006219.2         ATTCTTGGAAATTTCAAATCTAAGTTTGGCATTAAAAGGGAGCGAGTGCCTTTTATTCTT
XM_005247531.1      ATTCTTGGAAATTTCAAATCTAAGTTTGGCATTAAAAGGGAGCGAGTGCCTTTTATTCTT
                    ************************************************************

HsCD00505993        ACCTATGATTTCATCCATGTCATTCAACAAGGAAAAACAGGAAATACAGAAAAGTTTGGC
XM_005247532.1      ACCTATGATTTCATCCATGTCATTCAACAAGGAAAAACAGGAAATACAGAAAAGTTTGGC
XM_005247530.1      ACCTATGATTTCATCCATGTCATTCAACAAGGAAAAACAGGAAATACAGAAAAGTTTGGC
NM_006219.2         ACCTATGATTTCATCCATGTCATTCAACAAGGAAAAACAGGAAATACAGAAAAGTTTGGC
XM_005247531.1      ACCTATGATTTCATCCATGTCATTCAACAAGGAAAAACAGGAAATACAGAAAAGTTTGGC
                    ************************************************************

HsCD00505993        CGGTTCCGCCAGTGTTGTGAGGATGCATATCTGATTTTACGACGGCATGGGAATCTCTTC
XM_005247532.1      CGGTTCCGCCAGTGTTGTGAGGATGCATATCTGATTTTACGACGGCATGGGAATCTCTTC
XM_005247530.1      CGGTTCCGCCAGTGTTGTGAGGATGCATATCTGATTTTACGACGGCATGGGAATCTCTTC
NM_006219.2         CGGTTCCGCCAGTGTTGTGAGGATGCATATCTGATTTTACGACGGCATGGGAATCTCTTC
XM_005247531.1      CGGTTCCGCCAGTGTTGTGAGGATGCATATCTGATTTTACGACGGCATGGGAATCTCTTC
                    ************************************************************

HsCD00505993        ATCACTCTCTTTGCGCTGATGTTGACTGCAGGGCTTCCTGAACTCACATCAGTCAAAGAT
XM_005247532.1      ATCACTCTCTTTGCGCTGATGTTGACTGCAGGGCTTCCTGAACTCACATCAGTCAAAGAT
XM_005247530.1      ATCACTCTCTTTGCGCTGATGTTGACTGCAGGGCTTCCTGAACTCACATCAGTCAAAGAT
NM_006219.2         ATCACTCTCTTTGCGCTGATGTTGACTGCAGGGCTTCCTGAACTCACATCAGTCAAAGAT
XM_005247531.1      ATCACTCTCTTTGCGCTGATGTTGACTGCAGGGCTTCCTGAACTCACATCAGTCAAAGAT
                    ************************************************************

HsCD00505993        ATACAGTATCTTAAGGACTCTCTTGCATTAGGGAAGAGTGAAGAAGAAGCACTCAAACAG
XM_005247532.1      ATACAGTATCTTAAGGACTCTCTTGCATTAGGGAAGAGTGAAGAAGAAGCACTCAAACAG
XM_005247530.1      ATACAGTATCTTAAGGACTCTCTTGCATTAGGGAAGAGTGAAGAAGAAGCACTCAAACAG
NM_006219.2         ATACAGTATCTTAAGGACTCTCTTGCATTAGGGAAGAGTGAAGAAGAAGCACTCAAACAG
XM_005247531.1      ATACAGTATCTTAAGGACTCTCTTGCATTAGGGAAGAGTGAAGAAGAAGCACTCAAACAG
                    ************************************************************

HsCD00505993        TTTAAGCAAAAATTTGATGAGGCGCTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATG
XM_005247532.1      TTTAAGCAAAAATTTGATGAGGCGCTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATG
XM_005247530.1      TTTAAGCAAAAATTTGATGAGGCGCTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATG
NM_006219.2         TTTAAGCAAAAATTTGATGAGGCGCTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATG
XM_005247531.1      TTTAAGCAAAAATTTGATGAGGCGCTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATG
                    ************************************************************

HsCD00505993        GCCCACACAGTTCGGAAAGACTACAGATCT---
XM_005247532.1      GCCCACACAGTTCGGAAAGACTACAGATCTTAA
XM_005247530.1      GCCCACACAGTTCGGAAAGACTACAGATCTTAA
NM_006219.2         GCCCACACAGTTCGGAAAGACTACAGATCTTAA
XM_005247531.1      GCCCACACAGTTCGGAAAGACTACAGATCTTAA
                    ******************************   

Pathways

NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : EGF receptor (ErbB1) signaling pathway
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : ErbB4 signaling events
NCI : FAS (CD95) signaling pathway
NCI : Internalization of ErbB1
NCI : LPA receptor mediated events
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : PDGFR-beta signaling pathway
NCI : Signaling events mediated by TCPTP
NCI : TRAIL signaling pathway
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : Axon guidance mediated by netrin
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : PI3 kinase pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : Adaptive Immune System
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream TCR signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : GAB1 signalosome
Reactome : GPVI-mediated activation cascade
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nephrin interactions
Reactome : PI Metabolism
Reactome : PI-3K cascade
Reactome : PI3K Cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phospholipid metabolism
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of signaling by CBL
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Role of phospholipids in phagocytosis
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Synthesis of PIPs at the plasma membrane
Reactome : TCR signaling
Reactome : Tie2 Signaling
WikiPathway : AMPK signaling
WikiPathway : Focal Adhesion
WikiPathway : G13 Signaling Pathway
WikiPathway : Insulin Signaling
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 667555
Original Clone ID : ccsbBroadEn_01202

Organism


TAX_ID : 9606
Species Specific ID: 5291

Genome

Chromosome : 3
Map Location : 3q22.3

Reagents

Labome : PIK3CB-antibody