DNASU Plasmid Repository • 480.965.5697 | Email

GP9 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GP9
Gene Name:  glycoprotein IX (platelet)
Sequence             
Original Clone ID: ccsbBroadEn_06303
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC030229.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00506544

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 532nts         Open reading frame : 1 to 532

ATGCCTGCCTGGGGAGCCCTGTTCCTGCTCTGGGCCACAGCAGAGGCCACCAAGGACTGC
CCCAGCCCATGTACCTGCCGCGCCCTGGAAACCATGGGGCTGTGGGTGGACTGCAGGGGC
CACGGACTCACGGCCCTGCCTGCCCTGCCGGCCCGCACCCGCCACCTTCTGCTGGCCAAC
AACAGCCTTCAGTCCGTGCCCCCGGGAGCCTTTGACCACCTGCCCCAGCTGCAGACCCTC
GATGTGACGCAGAACCCCTGGCACTGTGACTGCAGCCTCACCTATCTGCGCCTCTGGCTG
GAGGACCGCACGCCCGAGGCCCTGCTGCAGGTCCGCTGTGCCAGCCCCAGCCTCGCTGCC
CATGGCCCGCTGGGCCGGCTGACAGGCTACCAGCTGGGCAGCTGTGGCTGGCAGCTGCAG
GCGTCCTGGGTGCGCCCGGGGGTCTTGTGGGACGTGGCGCTGGTCACCGTGGCCGCGCTG
GGCCTGGCTCTTCTGGCTGGCCTGCTGTGTGCCACCACAGAGGCCCTGGAT


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GP9
Symbol Nomenclature : GP9
SYNONYM : CD42a; GPIX
Designation : GP-IX|glycoprotein 9|platelet glycoprotein IX
Full Nomenclature : glycoprotein IX (platelet)
GENEID : 2815
GenBank Accession : DQ896655
HGNC : 4444
MIM : 173515
Vega : OTTHUMG00000159944
Target GenBank: DQ896655

 

Pathways

Panther : Blood coagulation
Reactome : Formation of Fibrin Clot (Clotting Cascade)
Reactome : GP1b-IX-V activation signalling
Reactome : Hemostasis
Reactome : Intrinsic Pathway
Reactome : Platelet Adhesion to exposed collagen
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation

Clone

Cloning Information : 615331
Original Clone ID : ccsbBroadEn_06303

Organism


TAX_ID : 9606
Species Specific ID: 2815

Genome

Chromosome : 3
Map Location : 3q21.3
Ensembl : ENSG00000169704

Reagents

Labome : GP9-antibody