DNASU Plasmid Repository • 480.965.5697 | Email

FGF19 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FGF19
Gene Name:  fibroblast growth factor 19
Sequence             
Original Clone ID: ccsbBroadEn_02277
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC017664.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00507020

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 649nts         Open reading frame : 1 to 649
Reference Sequence Alignment

ATGCGGAGCGGGTGTGTGGTGGTCCACGTATGGATCCTGGCCGGCCTCTGGCTGGCCGTG
GCCGGGCGCCCCCTCGCCTTCTCGGACGCGGGGCCCCACGTGCACTACGGCTGGGGCGAC
CCCATCCGCCTGCGGCACCTGTACACCTCCGGCCCCCACGGGCTCTCCAGCTGCTTCCTG
CGCATCCGTGCCGACGGCGTCGTGGACTGCGCGCGGGGCCAGAGCGCGCACAGTTTGCTG
GAGATCAAGGCAGTCGCTCTGCGGACCGTGGCCATCAAGGGCGTGCACAGCGTGCGGTAC
CTCTGCATGGGCGCCGACGGCAAGATGCAGGGGCTGCTTCAGTACTCGGAGGAAGACTGT
GCTTTCGAGGAGGAGATCCGCCCAGATGGCTACAATGTGTACCGATCCGAGAAGCACCGC
CTCCCGGTCTCCCTGAGCAGTGCCAAACAGCGGCAGCTGTACAAGAACAGAGGCTTTCTT
CCACTCTCTCATTTCCTGCCCATGCTGCCCATGGTCCCAGAGGAGCCTGAGGACCTCAGG
GGCCACTTGGAATCTGACATGTTCTCTTCGCCCCTGGAGACCGACAGCATGGACCCATTT
GGGCTTGTCACCGGACTGGAGGCCGTGAGGAGTCCCAGCTTTGAGAAG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FGF19
Symbol Nomenclature : FGF19
Designation : FGF-19
Full Nomenclature : fibroblast growth factor 19
GENEID : 9965
Locus Tag : UNQ334/PRO533
GenBank Accession : JF432499
HGNC : 3675
MIM : 603891
Vega : OTTHUMG00000167886
Target GenBank: JF432499

 

Reference Sequence Alignment

  

HsCD00507020      ATGCGGAGCGGGTGTGTGGTGGTCCACGTATGGATCCTGGCCGGCCTCTGGCTGGCCGTG
NM_005117.2       ATGCGGAGCGGGTGTGTGGTGGTCCACGTATGGATCCTGGCCGGCCTCTGGCTGGCCGTG
                  ************************************************************

HsCD00507020      GCCGGGCGCCCCCTCGCCTTCTCGGACGCGGGGCCCCACGTGCACTACGGCTGGGGCGAC
NM_005117.2       GCCGGGCGCCCCCTCGCCTTCTCGGACGCGGGGCCCCACGTGCACTACGGCTGGGGCGAC
                  ************************************************************

HsCD00507020      CCCATCCGCCTGCGGCACCTGTACACCTCCGGCCCCCACGGGCTCTCCAGCTGCTTCCTG
NM_005117.2       CCCATCCGCCTGCGGCACCTGTACACCTCCGGCCCCCACGGGCTCTCCAGCTGCTTCCTG
                  ************************************************************

HsCD00507020      CGCATCCGTGCCGACGGCGTCGTGGACTGCGCGCGGGGCCAGAGCGCGCACAGTTTGCTG
NM_005117.2       CGCATCCGTGCCGACGGCGTCGTGGACTGCGCGCGGGGCCAGAGCGCGCACAGTTTGCTG
                  ************************************************************

HsCD00507020      GAGATCAAGGCAGTCGCTCTGCGGACCGTGGCCATCAAGGGCGTGCACAGCGTGCGGTAC
NM_005117.2       GAGATCAAGGCAGTCGCTCTGCGGACCGTGGCCATCAAGGGCGTGCACAGCGTGCGGTAC
                  ************************************************************

HsCD00507020      CTCTGCATGGGCGCCGACGGCAAGATGCAGGGGCTGCTTCAGTACTCGGAGGAAGACTGT
NM_005117.2       CTCTGCATGGGCGCCGACGGCAAGATGCAGGGGCTGCTTCAGTACTCGGAGGAAGACTGT
                  ************************************************************

HsCD00507020      GCTTTCGAGGAGGAGATCCGCCCAGATGGCTACAATGTGTACCGATCCGAGAAGCACCGC
NM_005117.2       GCTTTCGAGGAGGAGATCCGCCCAGATGGCTACAATGTGTACCGATCCGAGAAGCACCGC
                  ************************************************************

HsCD00507020      CTCCCGGTCTCCCTGAGCAGTGCCAAACAGCGGCAGCTGTACAAGAACAGAGGCTTTCTT
NM_005117.2       CTCCCGGTCTCCCTGAGCAGTGCCAAACAGCGGCAGCTGTACAAGAACAGAGGCTTTCTT
                  ************************************************************

HsCD00507020      CCACTCTCTCATTTCCTGCCCATGCTGCCCATGGTCCCAGAGGAGCCTGAGGACCTCAGG
NM_005117.2       CCACTCTCTCATTTCCTGCCCATGCTGCCCATGGTCCCAGAGGAGCCTGAGGACCTCAGG
                  ************************************************************

HsCD00507020      GGCCACTTGGAATCTGACATGTTCTCTTCGCCCCTGGAGACCGACAGCATGGACCCATTT
NM_005117.2       GGCCACTTGGAATCTGACATGTTCTCTTCGCCCCTGGAGACCGACAGCATGGACCCATTT
                  ************************************************************

HsCD00507020      GGGCTTGTCACCGGACTGGAGGCCGTGAGGAGTCCCAGCTTTGAGAAG---
NM_005117.2       GGGCTTGTCACCGGACTGGAGGCCGTGAGGAGTCCCAGCTTTGAGAAGTAA
                  ************************************************   

Pathways

NCI : FGF signaling pathway
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : FGFR ligand binding and activation
Reactome : FGFR4 ligand binding and activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Klotho-mediated ligand binding
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of FGFR signaling
Reactome : PI-3K cascade
Reactome : PI3K Cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC-mediated cascade
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by Insulin receptor
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : betaKlotho-mediated ligand binding
WikiPathway : Neural Crest Differentiation

Clone

Cloning Information : 615713
Original Clone ID : ccsbBroadEn_02277

Organism


TAX_ID : 9606
Species Specific ID: 9965

Genome

Chromosome : 11
Map Location : 11q13.1
Ensembl : ENSG00000162344

Reagents

Labome : FGF19-antibody