DNASU Plasmid Repository • 480.965.5697 | Email

FADD (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FADD
Gene Name:  Fas (TNFRSF6)-associated via death domain
Sequence             
Original Clone ID: ccsbBroadEn_02012
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC000334.2
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00507408

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 625nts         Open reading frame : 1 to 625
Reference Sequence Alignment

ATGGACCCGTTCCTGGTGCTGCTGCACTCGGTGTCGTCCAGCCTGTCGAGCAGCGAGCTG
ACCGAGCTCAAGTTCCTATGCCTCGGGCGCGTGGGCAAGCGCAAGCTGGAGCGCGTGCAG
AGCGGCCTAGACCTCTTCTCCATGCTGCTGGAGCAGAACGACCTGGAGCCCGGGCACACC
GAGCTCCTGCGCGAGCTGCTCGCCTCCCTGCGGCGCCACGACCTGCTGCGGCGCGTCGAC
GACTTCGAGGCGGGGGCGGCGGCCGGGGCCGCGCCTGGGGAAGAAGACCTGTGTGCAGCA
TTTAACGTCATATGTGATAATGTGGGGAAAGATTGGAGAAGGCTGGCTCGTCAGCTCAAA
GTCTCAGACACCAAGATCGACAGCATCGAGGACAGATACCCCCGCAACCTGACAGAGCGT
GTGCGGGAGTCACTGAGAATCTGGAAGAACACAGAGAAGGAGAACGCAACAGTGGCCCAC
CTGGTGGGGGCTCTCAGGTCCTGCCAGATGAACCTGGTGGCTGACCTGGTACAAGAGGTT
CAGCAGGCCCGTGACCTCCAGAACAGGAGTGGGGCCATGTCCCCGATGTCATGGAACTCA
GACGCATCTACCTCCGAAGCGTCC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FADD
Symbol Nomenclature : FADD
SYNONYM : MORT1
Designation : Fas-associating death domain-containing protein|Fas-associating protein with death domain|growth-inhibiting gene 3 protein|mediator of receptor induced toxicity|mediator of receptor-induced toxicity|protein FADD
Full Nomenclature : Fas (TNFRSF6)-associated via death domain
GENEID : 8772
Locus Tag : GIG3
GenBank Accession : EU176185
HGNC : 3573
MIM : 602457
Vega : OTTHUMG00000167264
Target GenBank: EU176185

 

Reference Sequence Alignment

  

HsCD00507408      ATGGACCCGTTCCTGGTGCTGCTGCACTCGGTGTCGTCCAGCCTGTCGAGCAGCGAGCTG
NM_003824.3       ATGGACCCGTTCCTGGTGCTGCTGCACTCGGTGTCGTCCAGCCTGTCGAGCAGCGAGCTG
                  ************************************************************

HsCD00507408      ACCGAGCTCAAGTTCCTATGCCTCGGGCGCGTGGGCAAGCGCAAGCTGGAGCGCGTGCAG
NM_003824.3       ACCGAGCTCAAGTTCCTATGCCTCGGGCGCGTGGGCAAGCGCAAGCTGGAGCGCGTGCAG
                  ************************************************************

HsCD00507408      AGCGGCCTAGACCTCTTCTCCATGCTGCTGGAGCAGAACGACCTGGAGCCCGGGCACACC
NM_003824.3       AGCGGCCTAGACCTCTTCTCCATGCTGCTGGAGCAGAACGACCTGGAGCCCGGGCACACC
                  ************************************************************

HsCD00507408      GAGCTCCTGCGCGAGCTGCTCGCCTCCCTGCGGCGCCACGACCTGCTGCGGCGCGTCGAC
NM_003824.3       GAGCTCCTGCGCGAGCTGCTCGCCTCCCTGCGGCGCCACGACCTGCTGCGGCGCGTCGAC
                  ************************************************************

HsCD00507408      GACTTCGAGGCGGGGGCGGCGGCCGGGGCCGCGCCTGGGGAAGAAGACCTGTGTGCAGCA
NM_003824.3       GACTTCGAGGCGGGGGCGGCGGCCGGGGCCGCGCCTGGGGAAGAAGACCTGTGTGCAGCA
                  ************************************************************

HsCD00507408      TTTAACGTCATATGTGATAATGTGGGGAAAGATTGGAGAAGGCTGGCTCGTCAGCTCAAA
NM_003824.3       TTTAACGTCATATGTGATAATGTGGGGAAAGATTGGAGAAGGCTGGCTCGTCAGCTCAAA
                  ************************************************************

HsCD00507408      GTCTCAGACACCAAGATCGACAGCATCGAGGACAGATACCCCCGCAACCTGACAGAGCGT
NM_003824.3       GTCTCAGACACCAAGATCGACAGCATCGAGGACAGATACCCCCGCAACCTGACAGAGCGT
                  ************************************************************

HsCD00507408      GTGCGGGAGTCACTGAGAATCTGGAAGAACACAGAGAAGGAGAACGCAACAGTGGCCCAC
NM_003824.3       GTGCGGGAGTCACTGAGAATCTGGAAGAACACAGAGAAGGAGAACGCAACAGTGGCCCAC
                  ************************************************************

HsCD00507408      CTGGTGGGGGCTCTCAGGTCCTGCCAGATGAACCTGGTGGCTGACCTGGTACAAGAGGTT
NM_003824.3       CTGGTGGGGGCTCTCAGGTCCTGCCAGATGAACCTGGTGGCTGACCTGGTACAAGAGGTT
                  ************************************************************

HsCD00507408      CAGCAGGCCCGTGACCTCCAGAACAGGAGTGGGGCCATGTCCCCGATGTCATGGAACTCA
NM_003824.3       CAGCAGGCCCGTGACCTCCAGAACAGGAGTGGGGCCATGTCCCCGATGTCATGGAACTCA
                  ************************************************************

HsCD00507408      GACGCATCTACCTCCGAAGCGTCC---
NM_003824.3       GACGCATCTACCTCCGAAGCGTCCTGA
                  ************************   

Pathways

NCI : Caspase Cascade in Apoptosis
NCI : Ceramide signaling pathway
NCI : FAS (CD95) signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : TNF receptor signaling pathway
NCI : TRAIL signaling pathway
Panther : Apoptosis signaling pathway
Panther : FAS signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Apoptosis
Reactome : Caspase-8 activation
Reactome : Death Receptor Signalling
Reactome : Dimerization of procaspase-8
Reactome : Extrinsic Pathway for Apoptosis
Reactome : FasL/ CD95L signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MyD88-independent cascade
Reactome : NF-kB activation through FADD/RIP-1 pathway mediated by caspase-8 and -10
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulation by c-FLIP
Reactome : TNF signaling
Reactome : TRAIL signaling
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : TRIF-mediated programmed cell death
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : Apoptosis Modulation by HSP70
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 666761
Original Clone ID : ccsbBroadEn_02012

Organism


TAX_ID : 9606
Species Specific ID: 8772

Genome

Chromosome : 11
Map Location : 11q13.3
Ensembl : ENSG00000168040

Reagents

Labome : FADD-antibody