DNASU Plasmid Repository • 480.965.5697 | Email

YWHAB (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  YWHAB
Gene Name:  tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta
Sequence             
Original Clone ID: ccsbBroadEn_01788
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC001359.2
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00507886

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 739nts         Open reading frame : 1 to 739
Reference Sequence Alignment

ATGACAATGGATAAAAGTGAGCTGGTACAGAAAGCCAAACTCGCTGAGCAGGCTGAGCGA
TATGATGATATGGCTGCAGCCATGAAGGCAGTCACAGAACAGGGGCATGAACTCTCCAAC
GAAGAGAGAAATCTGCTCTCTGTTGCCTACAAGAATGTGGTAGGCGCCCGCCGCTCTTCC
TGGCGTGTCATCTCCAGCATTGAGCAGAAAACAGAGAGGAATGAGAAGAAGCAGCAGATG
GGCAAAGAGTACCGTGAGAAGATAGAGGCAGAACTGCAGGACATCTGCAATGATGTTCTG
GAGCTGTTGGACAAATATCTTATTCCCAATGCTACACAACCAGAAAGTAAGGTGTTCTAC
TTGAAAATGAAAGGAGATTATTTTAGGTATCTTTCTGAAGTGGCATCTGGAGACAACAAA
CAAACCACTGTGTCGAACTCCCAGCAGGCTTACCAGGAAGCATTTGAAATTAGTAAGAAA
GAAATGCAGCCTACACACCCAATTCGTCTTGGTCTGGCACTAAATTTCTCAGTCTTTTAC
TATGAGATTCTAAACTCTCCTGAAAAGGCCTGTAGCCTGGCAAAAACGGCATTTGATGAA
GCAATTGCTGAATTGGATACGCTGAATGAAGAGTCTTATAAAGACAGCACTCTGATCATG
CAGTTACTTAGGGACAATCTCACTCTGTGGACATCGGAAAACCAGGGAGACGAAGGAGAC
GCTGGGGAGGGAGAGAAC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : YWHAB
Symbol Nomenclature : YWHAB
SYNONYM : GW128; HEL-S-1; HS1; KCIP-1; YWHAA
Designation : 14-3-3 alpha|14-3-3 protein beta/alpha|brain protein 14-3-3, beta isoform|epididymis secretory protein Li 1|protein 1054|protein kinase C inhibitor protein 1|protein kinase C inhibitor protein-1|tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, alpha polypeptide|tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
Full Nomenclature : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta
GENEID : 7529
Locus Tag : RP1-148E22.1
GenBank Accession : EU832419
HGNC : 12849
MIM : 601289
Vega : OTTHUMG00000032549
Target GenBank: EU832419

 

Reference Sequence Alignment

  

HsCD00507886      ATGACAATGGATAAAAGTGAGCTGGTACAGAAAGCCAAACTCGCTGAGCAGGCTGAGCGA
NM_003404.4       ATGACAATGGATAAAAGTGAGCTGGTACAGAAAGCCAAACTCGCTGAGCAGGCTGAGCGA
NM_139323.3       ATGACAATGGATAAAAGTGAGCTGGTACAGAAAGCCAAACTCGCTGAGCAGGCTGAGCGA
                  ************************************************************

HsCD00507886      TATGATGATATGGCTGCAGCCATGAAGGCAGTCACAGAACAGGGGCATGAACTCTCCAAC
NM_003404.4       TATGATGATATGGCTGCAGCCATGAAGGCAGTCACAGAACAGGGGCATGAACTCTCCAAC
NM_139323.3       TATGATGATATGGCTGCAGCCATGAAGGCAGTCACAGAACAGGGGCATGAACTCTCCAAC
                  ************************************************************

HsCD00507886      GAAGAGAGAAATCTGCTCTCTGTTGCCTACAAGAATGTGGTAGGCGCCCGCCGCTCTTCC
NM_003404.4       GAAGAGAGAAATCTGCTCTCTGTTGCCTACAAGAATGTGGTAGGCGCCCGCCGCTCTTCC
NM_139323.3       GAAGAGAGAAATCTGCTCTCTGTTGCCTACAAGAATGTGGTAGGCGCCCGCCGCTCTTCC
                  ************************************************************

HsCD00507886      TGGCGTGTCATCTCCAGCATTGAGCAGAAAACAGAGAGGAATGAGAAGAAGCAGCAGATG
NM_003404.4       TGGCGTGTCATCTCCAGCATTGAGCAGAAAACAGAGAGGAATGAGAAGAAGCAGCAGATG
NM_139323.3       TGGCGTGTCATCTCCAGCATTGAGCAGAAAACAGAGAGGAATGAGAAGAAGCAGCAGATG
                  ************************************************************

HsCD00507886      GGCAAAGAGTACCGTGAGAAGATAGAGGCAGAACTGCAGGACATCTGCAATGATGTTCTG
NM_003404.4       GGCAAAGAGTACCGTGAGAAGATAGAGGCAGAACTGCAGGACATCTGCAATGATGTTCTG
NM_139323.3       GGCAAAGAGTACCGTGAGAAGATAGAGGCAGAACTGCAGGACATCTGCAATGATGTTCTG
                  ************************************************************

HsCD00507886      GAGCTGTTGGACAAATATCTTATTCCCAATGCTACACAACCAGAAAGTAAGGTGTTCTAC
NM_003404.4       GAGCTGTTGGACAAATATCTTATTCCCAATGCTACACAACCAGAAAGTAAGGTGTTCTAC
NM_139323.3       GAGCTGTTGGACAAATATCTTATTCCCAATGCTACACAACCAGAAAGTAAGGTGTTCTAC
                  ************************************************************

HsCD00507886      TTGAAAATGAAAGGAGATTATTTTAGGTATCTTTCTGAAGTGGCATCTGGAGACAACAAA
NM_003404.4       TTGAAAATGAAAGGAGATTATTTTAGGTATCTTTCTGAAGTGGCATCTGGAGACAACAAA
NM_139323.3       TTGAAAATGAAAGGAGATTATTTTAGGTATCTTTCTGAAGTGGCATCTGGAGACAACAAA
                  ************************************************************

HsCD00507886      CAAACCACTGTGTCGAACTCCCAGCAGGCTTACCAGGAAGCATTTGAAATTAGTAAGAAA
NM_003404.4       CAAACCACTGTGTCGAACTCCCAGCAGGCTTACCAGGAAGCATTTGAAATTAGTAAGAAA
NM_139323.3       CAAACCACTGTGTCGAACTCCCAGCAGGCTTACCAGGAAGCATTTGAAATTAGTAAGAAA
                  ************************************************************

HsCD00507886      GAAATGCAGCCTACACACCCAATTCGTCTTGGTCTGGCACTAAATTTCTCAGTCTTTTAC
NM_003404.4       GAAATGCAGCCTACACACCCAATTCGTCTTGGTCTGGCACTAAATTTCTCAGTCTTTTAC
NM_139323.3       GAAATGCAGCCTACACACCCAATTCGTCTTGGTCTGGCACTAAATTTCTCAGTCTTTTAC
                  ************************************************************

HsCD00507886      TATGAGATTCTAAACTCTCCTGAAAAGGCCTGTAGCCTGGCAAAAACGGCATTTGATGAA
NM_003404.4       TATGAGATTCTAAACTCTCCTGAAAAGGCCTGTAGCCTGGCAAAAACGGCATTTGATGAA
NM_139323.3       TATGAGATTCTAAACTCTCCTGAAAAGGCCTGTAGCCTGGCAAAAACGGCATTTGATGAA
                  ************************************************************

HsCD00507886      GCAATTGCTGAATTGGATACGCTGAATGAAGAGTCTTATAAAGACAGCACTCTGATCATG
NM_003404.4       GCAATTGCTGAATTGGATACGCTGAATGAAGAGTCTTATAAAGACAGCACTCTGATCATG
NM_139323.3       GCAATTGCTGAATTGGATACGCTGAATGAAGAGTCTTATAAAGACAGCACTCTGATCATG
                  ************************************************************

HsCD00507886      CAGTTACTTAGGGACAATCTCACTCTGTGGACATCGGAAAACCAGGGAGACGAAGGAGAC
NM_003404.4       CAGTTACTTAGGGACAATCTCACTCTGTGGACATCGGAAAACCAGGGAGACGAAGGAGAC
NM_139323.3       CAGTTACTTAGGGACAATCTCACTCTGTGGACATCGGAAAACCAGGGAGACGAAGGAGAC
                  ************************************************************

HsCD00507886      GCTGGGGAGGGAGAGAAC---
NM_003404.4       GCTGGGGAGGGAGAGAACTAA
NM_139323.3       GCTGGGGAGGGAGAGAACTAA
                  ******************   

Pathways

NCI : ATM pathway
NCI : ATR signaling pathway
NCI : Class I PI3K signaling events mediated by Akt
NCI : ErbB1 downstream signaling
NCI : FoxO family signaling
NCI : Insulin-mediated glucose transport
NCI : LKB1 signaling events
NCI : PDGFR-beta signaling pathway
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Signaling events mediated by HDAC Class II
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : a6b1 and a6b4 Integrin signaling
NCI : mTOR signaling pathway
NCI : p38 signaling mediated by MAPKAP kinases
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Parkinson disease
Reactome : ARMS-mediated activation
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Adaptive Immune System
Reactome : Apoptosis
Reactome : Axon guidance
Reactome : Butyrate Response Factor 1 (BRF1) destabilizes mRNA
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : FCERI mediated MAPK activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Frs2-mediated activation
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Gene Expression
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin-2 signaling
Reactome : Intrinsic Pathway for Apoptosis
Reactome : MEK activation
Reactome : Membrane Trafficking
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Prolonged ERK activation events
Reactome : RAF activation
Reactome : RAF phosphorylates MEK
Reactome : RAF/MAP kinase cascade
Reactome : Rap1 signalling
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : SHC-mediated signalling
Reactome : SHC-related events
Reactome : SHC-related events triggered by IGF1R
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : SOS-mediated signalling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Hippo
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Signalling to p38 via RIT and RIN
Reactome : Translocation of GLUT4 to the plasma membrane
Reactome : Tristetraprolin (TTP) destabilizes mRNA
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Cell cycle
WikiPathway : Myometrial Relaxation and Contraction Pathways

Protein

SMART domain : 14_3_3 : 14-3-3 homologues
HPRD : 03184

Clone

Cloning Information : 666134
Original Clone ID : ccsbBroadEn_01788

Organism


TAX_ID : 9606
Species Specific ID: 7529

Genome

Chromosome : 20
Map Location : 20q13.1
Ensembl : ENSG00000166913