DNASU Plasmid Repository • 480.965.5697 | Email

RPA2 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RPA2
Gene Name:  replication protein A2, 32kDa
Sequence             
Original Clone ID: ccsbBroadEn_01413
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC001630.1,BC012157.1,BC021257.2
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00508178

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 811nts         Open reading frame : 1 to 811
Reference Sequence Alignment

ATGTGGAACAGTGGATTCGAAAGCTATGGCAGCTCCTCATACGGGGGAGCCGGCGGCTAC
ACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCTTCTCAAGCCGAAAAGAAATCAAGA
GCCCGAGCCCAGCACATTGTGCCCTGTACTATATCTCAGCTGCTTTCTGCCACTTTGGTT
GATGAAGTGTTCAGAATTGGGAATGTTGAGATTTCACAGGTCACTATTGTGGGGATCATC
AGACATGCAGAGAAGGCTCCAACCAACATTGTTTACAAAATAGATGACATGACAGCTGCA
CCCATGGACGTTCGCCAGTGGGTTGACACAGATGACACCAGCAGTGAAAACACTGTGGTT
CCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTGAGATCTTTTCAGAACAAAAAGAGC
CTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATGAATGAGTTCACCACACATATTCTG
GAAGTGATCAATGCACACATGGTACTAAGCAAAGCCAACAGCCAGCCCTCAGCAGGGAGA
GCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGGAACTTTGGTGGGAATAGCTTCATG
CCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTGTTGAATTTGATTAAGGCTTGTCCA
AGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAACCAGCTGAAACACATGTCTGTATCC
TCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAGGGGCACATCTATTCTACTGTGGAT
GATGACCATTTTAAATCCACAGATGCAGAA


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RPA2
Symbol Nomenclature : RPA2
SYNONYM : REPA2; RPA32
Designation : RF-A protein 2|RP-A p32|RP-A p34|replication factor A protein 2|replication protein A 32 kDa subunit|replication protein A 34 kDa subunit
Full Nomenclature : replication protein A2, 32kDa
GENEID : 6118
Locus Tag : RP4-547C9.3
GenBank Accession : DQ895821
HGNC : 10290
MIM : 179836
Vega : OTTHUMG00000003915
Target GenBank: DQ895821

 

Reference Sequence Alignment

  

HsCD00508178        ------------------------ATGTGGAACAGTGGATTCGAAAGCTATGGCAGCTCC
XM_005245965.1      ATGGGCAGAGGAGACAGGAACAAGCGTAGCATCCGTGGATTCGAAAGCTATGGCAGCTCC
NM_002946.4         ------------------------ATGTGGAACAGTGGATTCGAAAGCTATGGCAGCTCC
                                            .  :* *:*.**************************

HsCD00508178        TCATACGGGGGAGCCGGCGGCTACACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCT
XM_005245965.1      TCATACGGGGGAGCCGGCGGCTACACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCT
NM_002946.4         TCATACGGGGGAGCCGGCGGCTACACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCT
                    ************************************************************

HsCD00508178        TCTCAAGCCGAAAAGAAATCAAGAGCCCGAGCCCAGCACATTGTGCCCTGTACTATATCT
XM_005245965.1      TCTCAAGCCGAAAAGAAATCAAGAGCCCGAGCCCAGCACATTGTGCCCTGTACTATATCT
NM_002946.4         TCTCAAGCCGAAAAGAAATCAAGAGCCCGAGCCCAGCACATTGTGCCCTGTACTATATCT
                    ************************************************************

HsCD00508178        CAGCTGCTTTCTGCCACTTTGGTTGATGAAGTGTTCAGAATTGGGAATGTTGAGATTTCA
XM_005245965.1      CAGCTGCTTTCTGCCACTTTGGTTGATGAAGTGTTCAGAATTGGGAATGTTGAGATTTCA
NM_002946.4         CAGCTGCTTTCTGCCACTTTGGTTGATGAAGTGTTCAGAATTGGGAATGTTGAGATTTCA
                    ************************************************************

HsCD00508178        CAGGTCACTATTGTGGGGATCATCAGACATGCAGAGAAGGCTCCAACCAACATTGTTTAC
XM_005245965.1      CAGGTCACTATTGTGGGGATCATCAGACATGCAGAGAAGGCTCCAACCAACATTGTTTAC
NM_002946.4         CAGGTCACTATTGTGGGGATCATCAGACATGCAGAGAAGGCTCCAACCAACATTGTTTAC
                    ************************************************************

HsCD00508178        AAAATAGATGACATGACAGCTGCACCCATGGACGTTCGCCAGTGGGTTGACACAGATGAC
XM_005245965.1      AAAATAGATGACATGACAGCTGCACCCATGGACGTTCGCCAGTGGGTTGACACAGATGAC
NM_002946.4         AAAATAGATGACATGACAGCTGCACCCATGGACGTTCGCCAGTGGGTTGACACAGATGAC
                    ************************************************************

HsCD00508178        ACCAGCAGTGAAAACACTGTGGTTCCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTG
XM_005245965.1      ACCAGCAGTGAAAACACTGTGGTTCCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTG
NM_002946.4         ACCAGCAGTGAAAACACTGTGGTTCCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTG
                    ************************************************************

HsCD00508178        AGATCTTTTCAGAACAAAAAGAGCCTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATG
XM_005245965.1      AGATCTTTTCAGAACAAAAAGAGCCTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATG
NM_002946.4         AGATCTTTTCAGAACAAAAAGAGCCTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATG
                    ************************************************************

HsCD00508178        AATGAGTTCACCACACATATTCTGGAAGTGATCAATGCACACATGGTACTAAGCAAAGCC
XM_005245965.1      AATGAGTTCACCACACATATTCTGGAAGTGATCAATGCACACATGGTACTAAGCAAAGCC
NM_002946.4         AATGAGTTCACCACACATATTCTGGAAGTGATCAATGCACACATGGTACTAAGCAAAGCC
                    ************************************************************

HsCD00508178        AACAGCCAGCCCTCAGCAGGGAGAGCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGG
XM_005245965.1      AACAGCCAGCCCTCAGCAGGGAGAGCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGG
NM_002946.4         AACAGCCAGCCCTCAGCAGGGAGAGCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGG
                    ************************************************************

HsCD00508178        AACTTTGGTGGGAATAGCTTCATGCCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTG
XM_005245965.1      AACTTTGGTGGGAATAGCTTCATGCCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTG
NM_002946.4         AACTTTGGTGGGAATAGCTTCATGCCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTG
                    ************************************************************

HsCD00508178        TTGAATTTGATTAAGGCTTGTCCAAGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAAC
XM_005245965.1      TTGAATTTGATTAAGGCTTGTCCAAGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAAC
NM_002946.4         TTGAATTTGATTAAGGCTTGTCCAAGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAAC
                    ************************************************************

HsCD00508178        CAGCTGAAACACATGTCTGTATCCTCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAG
XM_005245965.1      CAGCTGAAACACATGTCTGTATCCTCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAG
NM_002946.4         CAGCTGAAACACATGTCTGTATCCTCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAG
                    ************************************************************

HsCD00508178        GGGCACATCTATTCTACTGTGGATGATGACCATTTTAAATCCACAGATGCAGAA---
XM_005245965.1      GGGCACATCTATTCTACTGTGGATGATGACCATTTTAAATCCACAGATGCAGAATAA
NM_002946.4         GGGCACATCTATTCTACTGTGGATGATGACCATTTTAAATCCACAGATGCAGAATAA
                    ******************************************************   

Pathways

NCI : ATR signaling pathway
NCI : Fanconi anemia pathway
Panther : DNA replication
Reactome : Activation of ATR in response to replication stress
Reactome : Activation of the pre-replicative complex
Reactome : Assembly of the RAD51-ssDNA nucleoprotein complex
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : DNA strand elongation
Reactome : Double-Strand Break Repair
Reactome : Dual incision reaction in GG-NER
Reactome : Extension of Telomeres
Reactome : Formation of incision complex in GG-NER
Reactome : G1/S Transition
Reactome : G2/M Checkpoints
Reactome : Gap-filling DNA repair synthesis and ligation in GG-NER
Reactome : Gap-filling DNA repair synthesis and ligation in TC-NER
Reactome : Global Genomic NER (GG-NER)
Reactome : HSF1 activation
Reactome : Homologous DNA pairing and strand exchange
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Lagging Strand Synthesis
Reactome : M/G1 Transition
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Nucleotide Excision Repair
Reactome : Presynaptic phase of homologous DNA pairing and strand exchange
Reactome : Processing of DNA double-strand break ends
Reactome : Processive synthesis on the C-strand of the telomere
Reactome : Processive synthesis on the lagging strand
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Removal of the Flap Intermediate
Reactome : Removal of the Flap Intermediate from the C-strand
Reactome : Repair synthesis for gap-filling by DNA polymerase in TC-NER
Reactome : Repair synthesis of patch ~27-30 bases long by DNA polymerase
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance
Reactome : Transcription-coupled NER (TC-NER)
WikiPathway : DNA Replication
WikiPathway : DNA damage response
WikiPathway : G1 to S cell cycle control
WikiPathway : miRNA regulation of DNA Damage Response

Protein

HPRD : 01566

Clone

Cloning Information : 612833
Original Clone ID : ccsbBroadEn_01413

Organism


TAX_ID : 9606
Species Specific ID: 6118

Genome

Chromosome : 1
Map Location : 1p35
Ensembl : ENSG00000117748

Reagents

Labome : RPA2-antibody