DNASU Plasmid Repository • 480.965.5697 | Email

CASP3 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CASP3
Gene Name:  caspase 3, apoptosis-related cysteine peptidase
Sequence             
Original Clone ID: ccsbBroadEn_00221
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC016926.2
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00508713

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 832nts         Open reading frame : 1 to 832
Reference Sequence Alignment

ATGGAGAACACTGAAAACTCAGTGGATTCAAAATCCATTAAAAATTTGGAACCAAAGATC
ATACATGGAAGCGAATCAATGGACTCTGGAATATCCCTGGACAACAGTTATAAAATGGAT
TATCCTGAGATGGGTTTATGTATAATAATTAATAATAAGAATTTTCATAAAAGCACTGGA
ATGACATCTCGGTCTGGTACAGATGTCGATGCAGCAAACCTCAGGGAAACATTCAGAAAC
TTGAAATATGAAGTCAGGAATAAAAATGATCTTACACGTGAAGAAATTGTGGAATTGATG
CGTGATGTTTCTAAAGAAGATCACAGCAAAAGGAGCAGTTTTGTTTGTGTGCTTCTGAGC
CATGGTGAAGAAGGAATAATTTTTGGAACAAATGGACCTGTTGACCTGAAAAAAATAACA
AACTTTTTCAGAGGGGATCGTTGTAGAAGTCTAACTGGAAAACCCAAACTTTTCATTATT
CAGGCCTGCCGTGGTACAGAACTGGACTGTGGCATTGAGACAGACAGTGGTGTTGATGAT
GACATGGCGTGTCATAAAATACCAGTGGAGGCCGACTTCTTGTATGCATACTCCACAGCA
CCTGGTTATTATTCTTGGCGAAATTCAAAGGATGGCTCCTGGTTCATCCAGTCGCTTTGT
GCCATGCTGAAACAGTATGCCGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAAC
CGAAAGGTGGCAACAGAATTTGAGTCCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAA
CAGATTCCATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTATCAC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CASP3
Symbol Nomenclature : CASP3
SYNONYM : CPP32; CPP32B; SCA-1
Designation : CASP-3|CPP-32|PARP cleavage protease|SREBP cleavage activity 1|apopain|caspase 3, apoptosis-related cysteine protease|caspase-3|cysteine protease CPP32|procaspase3|protein Yama
Full Nomenclature : caspase 3, apoptosis-related cysteine peptidase
GENEID : 836
GenBank Accession : DQ894731
HGNC : 1504
MIM : 600636
Vega : OTTHUMG00000133681
Target GenBank: DQ894731

 

Reference Sequence Alignment

  

HsCD00508713      ATGGAGAACACTGAAAACTCAGTGGATTCAAAATCCATTAAAAATTTGGAACCAAAGATC
NM_004346.3       ATGGAGAACACTGAAAACTCAGTGGATTCAAAATCCATTAAAAATTTGGAACCAAAGATC
NM_032991.2       ATGGAGAACACTGAAAACTCAGTGGATTCAAAATCCATTAAAAATTTGGAACCAAAGATC
                  ************************************************************

HsCD00508713      ATACATGGAAGCGAATCAATGGACTCTGGAATATCCCTGGACAACAGTTATAAAATGGAT
NM_004346.3       ATACATGGAAGCGAATCAATGGACTCTGGAATATCCCTGGACAACAGTTATAAAATGGAT
NM_032991.2       ATACATGGAAGCGAATCAATGGACTCTGGAATATCCCTGGACAACAGTTATAAAATGGAT
                  ************************************************************

HsCD00508713      TATCCTGAGATGGGTTTATGTATAATAATTAATAATAAGAATTTTCATAAAAGCACTGGA
NM_004346.3       TATCCTGAGATGGGTTTATGTATAATAATTAATAATAAGAATTTTCATAAAAGCACTGGA
NM_032991.2       TATCCTGAGATGGGTTTATGTATAATAATTAATAATAAGAATTTTCATAAAAGCACTGGA
                  ************************************************************

HsCD00508713      ATGACATCTCGGTCTGGTACAGATGTCGATGCAGCAAACCTCAGGGAAACATTCAGAAAC
NM_004346.3       ATGACATCTCGGTCTGGTACAGATGTCGATGCAGCAAACCTCAGGGAAACATTCAGAAAC
NM_032991.2       ATGACATCTCGGTCTGGTACAGATGTCGATGCAGCAAACCTCAGGGAAACATTCAGAAAC
                  ************************************************************

HsCD00508713      TTGAAATATGAAGTCAGGAATAAAAATGATCTTACACGTGAAGAAATTGTGGAATTGATG
NM_004346.3       TTGAAATATGAAGTCAGGAATAAAAATGATCTTACACGTGAAGAAATTGTGGAATTGATG
NM_032991.2       TTGAAATATGAAGTCAGGAATAAAAATGATCTTACACGTGAAGAAATTGTGGAATTGATG
                  ************************************************************

HsCD00508713      CGTGATGTTTCTAAAGAAGATCACAGCAAAAGGAGCAGTTTTGTTTGTGTGCTTCTGAGC
NM_004346.3       CGTGATGTTTCTAAAGAAGATCACAGCAAAAGGAGCAGTTTTGTTTGTGTGCTTCTGAGC
NM_032991.2       CGTGATGTTTCTAAAGAAGATCACAGCAAAAGGAGCAGTTTTGTTTGTGTGCTTCTGAGC
                  ************************************************************

HsCD00508713      CATGGTGAAGAAGGAATAATTTTTGGAACAAATGGACCTGTTGACCTGAAAAAAATAACA
NM_004346.3       CATGGTGAAGAAGGAATAATTTTTGGAACAAATGGACCTGTTGACCTGAAAAAAATAACA
NM_032991.2       CATGGTGAAGAAGGAATAATTTTTGGAACAAATGGACCTGTTGACCTGAAAAAAATAACA
                  ************************************************************

HsCD00508713      AACTTTTTCAGAGGGGATCGTTGTAGAAGTCTAACTGGAAAACCCAAACTTTTCATTATT
NM_004346.3       AACTTTTTCAGAGGGGATCGTTGTAGAAGTCTAACTGGAAAACCCAAACTTTTCATTATT
NM_032991.2       AACTTTTTCAGAGGGGATCGTTGTAGAAGTCTAACTGGAAAACCCAAACTTTTCATTATT
                  ************************************************************

HsCD00508713      CAGGCCTGCCGTGGTACAGAACTGGACTGTGGCATTGAGACAGACAGTGGTGTTGATGAT
NM_004346.3       CAGGCCTGCCGTGGTACAGAACTGGACTGTGGCATTGAGACAGACAGTGGTGTTGATGAT
NM_032991.2       CAGGCCTGCCGTGGTACAGAACTGGACTGTGGCATTGAGACAGACAGTGGTGTTGATGAT
                  ************************************************************

HsCD00508713      GACATGGCGTGTCATAAAATACCAGTGGAGGCCGACTTCTTGTATGCATACTCCACAGCA
NM_004346.3       GACATGGCGTGTCATAAAATACCAGTGGAGGCCGACTTCTTGTATGCATACTCCACAGCA
NM_032991.2       GACATGGCGTGTCATAAAATACCAGTGGAGGCCGACTTCTTGTATGCATACTCCACAGCA
                  ************************************************************

HsCD00508713      CCTGGTTATTATTCTTGGCGAAATTCAAAGGATGGCTCCTGGTTCATCCAGTCGCTTTGT
NM_004346.3       CCTGGTTATTATTCTTGGCGAAATTCAAAGGATGGCTCCTGGTTCATCCAGTCGCTTTGT
NM_032991.2       CCTGGTTATTATTCTTGGCGAAATTCAAAGGATGGCTCCTGGTTCATCCAGTCGCTTTGT
                  ************************************************************

HsCD00508713      GCCATGCTGAAACAGTATGCCGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAAC
NM_004346.3       GCCATGCTGAAACAGTATGCCGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAAC
NM_032991.2       GCCATGCTGAAACAGTATGCCGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAAC
                  ************************************************************

HsCD00508713      CGAAAGGTGGCAACAGAATTTGAGTCCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAA
NM_004346.3       CGAAAGGTGGCAACAGAATTTGAGTCCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAA
NM_032991.2       CGAAAGGTGGCAACAGAATTTGAGTCCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAA
                  ************************************************************

HsCD00508713      CAGATTCCATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTATCAC---
NM_004346.3       CAGATTCCATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTATCACTAA
NM_032991.2       CAGATTCCATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTATCACTAA
                  ***************************************************   

Pathways

NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Caspase Cascade in Apoptosis
NCI : FAS (CD95) signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : LPA receptor mediated events
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Syndecan-2-mediated signaling events
NCI : p75(NTR)-mediated signaling
Panther : Apoptosis signaling pathway
Panther : FAS signaling pathway
Panther : Huntington disease
Reactome : Activation of DNA fragmentation factor
Reactome : Activation of caspases through apoptosome-mediated cleavage
Reactome : Apoptosis
Reactome : Apoptosis induced DNA fragmentation
Reactome : Apoptotic cleavage of cell adhesion proteins
Reactome : Apoptotic cleavage of cellular proteins
Reactome : Apoptotic execution phase
Reactome : Apoptotic factor-mediated response
Reactome : Caspase-mediated cleavage of cytoskeletal proteins
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Cytochrome c-mediated apoptotic response
Reactome : Degradation of the extracellular matrix
Reactome : Extracellular matrix organization
Reactome : Intrinsic Pathway for Apoptosis
Reactome : NADE modulates death signalling
Reactome : Regulation of Apoptosis
Reactome : Role of DCC in regulating apoptosis
Reactome : SMAC binds to IAPs
Reactome : SMAC-mediated apoptotic response
Reactome : SMAC-mediated dissociation of IAP:caspase complexes
Reactome : Signal Transduction
Reactome : Signaling by Hippo
Reactome : Signalling by NGF
Reactome : Stimulation of the cell death response by PAK-2p34
Reactome : p75 NTR receptor-mediated signalling
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : Apoptosis Modulation by HSP70
WikiPathway : DNA damage response
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : MAPK signaling pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 613368
Original Clone ID : ccsbBroadEn_00221

Organism


TAX_ID : 9606
Species Specific ID: 836

Genome

Chromosome : 4
Map Location : 4q34
Ensembl : ENSG00000164305

Reagents

Labome : caspase-3-antibody