DNASU Plasmid Repository • 480.965.5697 | Email

PTPN1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PTPN1
Gene Name:  protein tyrosine phosphatase, non-receptor type 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH127899.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00005092

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1308nts         Open reading frame : 1 to 1308
Reference Sequence Alignment

ATGGAGATGGAAAAGGAGTTCGAGCAGATCGACAAGTCCGGGAGCTGGGCGGCCATTTAC
CAGGATATCCGACATGAAGCCAGTGACTTCCCATGTAGAGTGGCCAAGCTTCCTAAGAAC
AAAAACCGAAATAGGTACAGAGACGTCAGTCCCTTTGACCATAGTCGGATTAAACTACAT
CAAGAAGATAATGACTATATCAACGCTAGTTTGATAAAAATGGAAGAAGCCCAAAGGAGT
TACATTCTTACCCAGGGCCCTTTGCCTAACACATGCGGTCACTTTTGGGAGATGGTGTGG
GAGCAGAAAAGCAGGGGTGTCGTCATGCTCAACAGAGTGATGGAGAAAGGTTCGTTAAAA
TGCGCACAATACTGGCCACAAAAAGAAGAAAAAGAGATGATCTTTGAAGACACAAATTTG
AAATTAACATTGATCTCTGAAGATATCAAGTCATATTATACAGTGCGACAGCTAGAATTG
GAAAACCTTACAACCCAAGAAACTCGAGAGATCTTACATTTCCACTATACCACATGGCCT
GACTTTGGAGTCCCTGAATCACCAGCCTCATTCTTGAACTTTCTTTTCAAAGTCCGAGAG
TCAGGGTCACTCAGCCCGGAGCACGGGCCCGTTGTGGTGCACTGCAGTGCAGGCATCGGC
AGGTCTGGAACCTTCTGTCTGGCTGATACCTGCCTCTTGCTGATGGACAAGAGGAAAGAC
CCTTCTTCCGTTGATATCAAGAAAGTGCTGTTAGAAATGAGGAAGTTTCGGATGGGGTTG
ATCCAGACAGCCGACCAGCTGCGCTTCTCCTACCTGGCTGTGATCGAAGGTGCCAAATTC
ATCATGGGGGACTCTTCCGTGCAGGATCAGTGGAAGGAGCTTTCCCACGAGGACCTGGAG
CCCCCACCCGAGCATATCCCCCCACCTCCCCGGCCACCCAAACGAATCCTGGAGCCACAC
AATGGGAAATGCAGGGAGTTCTTCCCAAATCACCAGTGGGTGAAGGAAGAGACCCAGGAG
GATAAAGACTGCCCCATCAAGGAAGAAAAAGGAAGCCCCTTAAATGCCGCACCCTACGGC
ATCGAAAGCATGAGTCAAGACACTGAAGTTAGAAGTCGGGTCGTGGGGGGAAGTCTTCGA
GGTGCCCAGGCTGCCTCCCCAGCCAAAGGGGAGCCGTCACTGCCCGAGAAGGACGAGGAC
CATGCACTGAGTTACTGGAAGCCCTTCCTGGTCAACATGTGCGTGGCTACGGTCCTCACG
GCCGGCGCTTACCTCTGCTACAGGTTCCTGTTCAACAGCAACACAGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1398
Start on reference sequence 91
Mutations:
None
Discrepancy:
c697t
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PTPN1
Symbol Nomenclature : PTPN1
SYNONYM : PTP1B
Designation : protein tyrosine phosphatase, placental|protein-tyrosine phosphatase 1B|tyrosine-protein phosphatase non-receptor type 1
Full Nomenclature : protein tyrosine phosphatase, non-receptor type 1
GENEID : 5770
GI : 60831401
GenBank Accession : AY893931
HGNC : 9642
MIM : 176885
Vega : OTTHUMG00000032729
Target GenBank: M31724

 

Reference Sequence Alignment

  

HsCD00005092      ATGGAGATGGAAAAGGAGTTCGAGCAGATCGACAAGTCCGGGAGCTGGGCGGCCATTTAC
NM_002827.3       ATGGAGATGGAAAAGGAGTTCGAGCAGATCGACAAGTCCGGGAGCTGGGCGGCCATTTAC
                  ************************************************************

HsCD00005092      CAGGATATCCGACATGAAGCCAGTGACTTCCCATGTAGAGTGGCCAAGCTTCCTAAGAAC
NM_002827.3       CAGGATATCCGACATGAAGCCAGTGACTTCCCATGTAGAGTGGCCAAGCTTCCTAAGAAC
                  ************************************************************

HsCD00005092      AAAAACCGAAATAGGTACAGAGACGTCAGTCCCTTTGACCATAGTCGGATTAAACTACAT
NM_002827.3       AAAAACCGAAATAGGTACAGAGACGTCAGTCCCTTTGACCATAGTCGGATTAAACTACAT
                  ************************************************************

HsCD00005092      CAAGAAGATAATGACTATATCAACGCTAGTTTGATAAAAATGGAAGAAGCCCAAAGGAGT
NM_002827.3       CAAGAAGATAATGACTATATCAACGCTAGTTTGATAAAAATGGAAGAAGCCCAAAGGAGT
                  ************************************************************

HsCD00005092      TACATTCTTACCCAGGGCCCTTTGCCTAACACATGCGGTCACTTTTGGGAGATGGTGTGG
NM_002827.3       TACATTCTTACCCAGGGCCCTTTGCCTAACACATGCGGTCACTTTTGGGAGATGGTGTGG
                  ************************************************************

HsCD00005092      GAGCAGAAAAGCAGGGGTGTCGTCATGCTCAACAGAGTGATGGAGAAAGGTTCGTTAAAA
NM_002827.3       GAGCAGAAAAGCAGGGGTGTCGTCATGCTCAACAGAGTGATGGAGAAAGGTTCGTTAAAA
                  ************************************************************

HsCD00005092      TGCGCACAATACTGGCCACAAAAAGAAGAAAAAGAGATGATCTTTGAAGACACAAATTTG
NM_002827.3       TGCGCACAATACTGGCCACAAAAAGAAGAAAAAGAGATGATCTTTGAAGACACAAATTTG
                  ************************************************************

HsCD00005092      AAATTAACATTGATCTCTGAAGATATCAAGTCATATTATACAGTGCGACAGCTAGAATTG
NM_002827.3       AAATTAACATTGATCTCTGAAGATATCAAGTCATATTATACAGTGCGACAGCTAGAATTG
                  ************************************************************

HsCD00005092      GAAAACCTTACAACCCAAGAAACTCGAGAGATCTTACATTTCCACTATACCACATGGCCT
NM_002827.3       GAAAACCTTACAACCCAAGAAACTCGAGAGATCTTACATTTCCACTATACCACATGGCCT
                  ************************************************************

HsCD00005092      GACTTTGGAGTCCCTGAATCACCAGCCTCATTCTTGAACTTTCTTTTCAAAGTCCGAGAG
NM_002827.3       GACTTTGGAGTCCCTGAATCACCAGCCTCATTCTTGAACTTTCTTTTCAAAGTCCGAGAG
                  ************************************************************

HsCD00005092      TCAGGGTCACTCAGCCCGGAGCACGGGCCCGTTGTGGTGCACTGCAGTGCAGGCATCGGC
NM_002827.3       TCAGGGTCACTCAGCCCGGAGCACGGGCCCGTTGTGGTGCACTGCAGTGCAGGCATCGGC
                  ************************************************************

HsCD00005092      AGGTCTGGAACCTTCTGTCTGGCTGATACCTGCCTCTTGCTGATGGACAAGAGGAAAGAC
NM_002827.3       AGGTCTGGAACCTTCTGTCTGGCTGATACCTGCCTCTTGCTGATGGACAAGAGGAAAGAC
                  ************************************************************

HsCD00005092      CCTTCTTCCGTTGATATCAAGAAAGTGCTGTTAGAAATGAGGAAGTTTCGGATGGGGTTG
NM_002827.3       CCTTCTTCCGTTGATATCAAGAAAGTGCTGTTAGAAATGAGGAAGTTTCGGATGGGGCTG
                  ********************************************************* **

HsCD00005092      ATCCAGACAGCCGACCAGCTGCGCTTCTCCTACCTGGCTGTGATCGAAGGTGCCAAATTC
NM_002827.3       ATCCAGACAGCCGACCAGCTGCGCTTCTCCTACCTGGCTGTGATCGAAGGTGCCAAATTC
                  ************************************************************

HsCD00005092      ATCATGGGGGACTCTTCCGTGCAGGATCAGTGGAAGGAGCTTTCCCACGAGGACCTGGAG
NM_002827.3       ATCATGGGGGACTCTTCCGTGCAGGATCAGTGGAAGGAGCTTTCCCACGAGGACCTGGAG
                  ************************************************************

HsCD00005092      CCCCCACCCGAGCATATCCCCCCACCTCCCCGGCCACCCAAACGAATCCTGGAGCCACAC
NM_002827.3       CCCCCACCCGAGCATATCCCCCCACCTCCCCGGCCACCCAAACGAATCCTGGAGCCACAC
                  ************************************************************

HsCD00005092      AATGGGAAATGCAGGGAGTTCTTCCCAAATCACCAGTGGGTGAAGGAAGAGACCCAGGAG
NM_002827.3       AATGGGAAATGCAGGGAGTTCTTCCCAAATCACCAGTGGGTGAAGGAAGAGACCCAGGAG
                  ************************************************************

HsCD00005092      GATAAAGACTGCCCCATCAAGGAAGAAAAAGGAAGCCCCTTAAATGCCGCACCCTACGGC
NM_002827.3       GATAAAGACTGCCCCATCAAGGAAGAAAAAGGAAGCCCCTTAAATGCCGCACCCTACGGC
                  ************************************************************

HsCD00005092      ATCGAAAGCATGAGTCAAGACACTGAAGTTAGAAGTCGGGTCGTGGGGGGAAGTCTTCGA
NM_002827.3       ATCGAAAGCATGAGTCAAGACACTGAAGTTAGAAGTCGGGTCGTGGGGGGAAGTCTTCGA
                  ************************************************************

HsCD00005092      GGTGCCCAGGCTGCCTCCCCAGCCAAAGGGGAGCCGTCACTGCCCGAGAAGGACGAGGAC
NM_002827.3       GGTGCCCAGGCTGCCTCCCCAGCCAAAGGGGAGCCGTCACTGCCCGAGAAGGACGAGGAC
                  ************************************************************

HsCD00005092      CATGCACTGAGTTACTGGAAGCCCTTCCTGGTCAACATGTGCGTGGCTACGGTCCTCACG
NM_002827.3       CATGCACTGAGTTACTGGAAGCCCTTCCTGGTCAACATGTGCGTGGCTACGGTCCTCACG
                  ************************************************************

HsCD00005092      GCCGGCGCTTACCTCTGCTACAGGTTCCTGTTCAACAGCAACACAGAC
NM_002827.3       GCCGGCGCTTACCTCTGCTACAGGTTCCTGTTCAACAGCAACACATAG
                  ********************************************* * 

Pathways

NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : EGF receptor (ErbB1) signaling pathway
NCI : IGF1 pathway
NCI : Insulin Pathway
NCI : N-cadherin signaling events
NCI : PDGFR-beta signaling pathway
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by TCPTP
Panther : Cadherin signaling pathway
Reactome : Cytokine Signaling in Immune system
Reactome : Growth hormone receptor signaling
Reactome : Hemostasis
Reactome : Immune System
Reactome : Integrin alphaIIb beta3 signaling
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : Interferon gamma signaling
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of IFNA signaling
Reactome : Regulation of IFNG signaling
Reactome : Signal Transduction
WikiPathway : Insulin Signaling
WikiPathway : Leptin signaling pathway
WikiPathway : Prolactin Signaling Pathway

Clone

Cloning Information : 127899
HIP Master Clone ID : 104048
Original Clone ID : FLH127899.01L

Organism


TAX_ID : 9606
Species Specific ID: 5770

Genome

Chromosome : 20
Map Location : 20q13.1-q13.2
Ensembl : ENSG00000196396

Reagents

Labome : PTP1B-antibody