DNASU Plasmid Repository • 480.965.5697 | Email

EGFR (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  EGFR
Gene Name:  epidermal growth factor receptor
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH127805.01X
Keyword: short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1218nts         Open reading frame : 1 to 1218
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1462
Start on reference sequence 245

5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : EGFR
Symbol Nomenclature : EGFR
Designation : avian erythroblastic leukemia viral (v-erb-b) oncogene homolog|cell growth inhibiting protein 40|cell proliferation-inducing protein 61|proto-oncogene c-ErbB-1|receptor tyrosine-protein kinase erbB-1
Full Nomenclature : epidermal growth factor receptor
GENEID : 1956
GI : 60820434
GenBank Accession : AY893498
HGNC : 3236
MIM : 131550
Vega : OTTHUMG00000023661
Target GenBank: U48722


Reference Sequence Alignment





                  ********************************************* **************




                  ***************************************************** ******













HsCD00005098      ATCACAGGTTTGAGCTGA------------------------------------------
NM_201283.1       ATCACAGGTTTGAGCTGA------------------------------------------
                  ******** ** :    .                                          

HsCD00005098      ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201282.1       CATCCAAACTGCACCTACGGGTCCTAA---------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------CCATGT
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       AGAGCGGGAGCCCAGCTGCTCAGG------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ACTGA-------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ------------------------------------------------------------
NM_201284.1       ------------------------------------------------------------
NM_201282.1       ------------------------------------------------------------
NM_201283.1       ------------------------------------------------------------

HsCD00005098      ---------------------------------
NM_201284.1       ---------------------------------
NM_201282.1       ---------------------------------
NM_201283.1       ---------------------------------


NCI : Arf6 signaling events
NCI : Direct p53 effectors
NCI : E-cadherin signaling in keratinocytes
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EGFR-dependent Endothelin signaling events
NCI : ErbB receptor signaling network
NCI : ErbB1 downstream signaling
NCI : Internalization of ErbB1
NCI : LPA receptor mediated events
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Regulation of Telomerase
NCI : SHP2 signaling
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by TCPTP
NCI : Stabilization and expansion of the E-cadherin adherens junction
NCI : Syndecan-3-mediated signaling events
NCI : Thromboxane A2 receptor signaling
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : a6b1 and a6b4 Integrin signaling
Panther : Cadherin signaling pathway
Panther : EGF receptor signaling pathway
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR Transactivation by Gastrin
Reactome : EGFR downregulation
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Immune System
Reactome : Innate Immune System
Reactome : L1CAM interactions
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : Signal Transduction
Reactome : Signal transduction by L1
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by constitutively active EGFR
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : Androgen receptor signaling pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Epithelium TarBase
WikiPathway : ErbB signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Lymphocyte TarBase
WikiPathway : MAPK signaling pathway
WikiPathway : Muscle cell TarBase
WikiPathway : Regulation of Actin Cytoskeleton


SMART domain : FU : Furin-like repeats
UniProt : P00533
HPRD : 00579


Cloning Information : 127805
HIP Master Clone ID : 103954
Original Clone ID : FLH127805.01X


TAX_ID : 9606
Species Specific ID: 1956


Chromosome : 7
Map Location : 7p12
Ensembl : ENSG00000146648


Labome : EGFR-antibody