DNASU Plasmid Repository • 480.965.5697 | Email

OGG1 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  OGG1
Gene Name:  8-oxoguanine DNA glycosylase
Sequence             
Original Clone ID: ccsbBroadEn_06670
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC000657.2
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00510107

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1036nts         Open reading frame : 1 to 1036
Reference Sequence Alignment

ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGGTGCTGTTCAGT
GCCGACCTGCGCCAATGCCGCCATGCTCAGGAGCCACCAGCAAAGCGCAGAAAGGGTTCC
AAAGGGCCGGAAGGC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : OGG1
Symbol Nomenclature : OGG1
SYNONYM : HMMH; HOGG1; MUTM; OGH1
Designation : 8-hydroxyguanine DNA glycosylase|AP lyase|DNA-apurinic or apyrimidinic site lyase|N-glycosylase/DNA lyase|OGG1 type 1f
Full Nomenclature : 8-oxoguanine DNA glycosylase
GENEID : 4968
GenBank Accession : EU176392
HGNC : 8125
MIM : 601982
Vega : OTTHUMG00000097091
Target GenBank: EU176392

 

Reference Sequence Alignment

  

HsCD00510107      ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
NM_002542.5       ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
NM_016819.3       ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
NM_016821.2       ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
NM_016829.2       ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
NM_016820.3       ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
NM_016828.2       ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
                  ************************************************************

HsCD00510107      GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
NM_002542.5       GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
NM_016819.3       GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
NM_016821.2       GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
NM_016829.2       GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
NM_016820.3       GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
NM_016828.2       GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
                  ************************************************************

HsCD00510107      TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
NM_002542.5       TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
NM_016819.3       TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
NM_016821.2       TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
NM_016829.2       TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
NM_016820.3       TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
NM_016828.2       TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
                  ************************************************************

HsCD00510107      GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
NM_002542.5       GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
NM_016819.3       GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
NM_016821.2       GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
NM_016829.2       GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
NM_016820.3       GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
NM_016828.2       GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
                  ************************************************************

HsCD00510107      GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
NM_002542.5       GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
NM_016819.3       GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
NM_016821.2       GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
NM_016829.2       GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
NM_016820.3       GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
NM_016828.2       GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
                  ************************************************************

HsCD00510107      CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
NM_002542.5       CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
NM_016819.3       CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
NM_016821.2       CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
NM_016829.2       CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
NM_016820.3       CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
NM_016828.2       CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
                  ************************************************************

HsCD00510107      CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
NM_002542.5       CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
NM_016819.3       CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
NM_016821.2       CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
NM_016829.2       CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
NM_016820.3       CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
NM_016828.2       CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
                  ************************************************************

HsCD00510107      CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
NM_002542.5       CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
NM_016819.3       CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
NM_016821.2       CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
NM_016829.2       CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
NM_016820.3       CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
NM_016828.2       CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
                  ************************************************************

HsCD00510107      CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
NM_002542.5       CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
NM_016819.3       CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
NM_016821.2       CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
NM_016829.2       CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
NM_016820.3       CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
NM_016828.2       CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
                  ************************************************************

HsCD00510107      TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
NM_002542.5       TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
NM_016819.3       TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
NM_016821.2       TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
NM_016829.2       TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
NM_016820.3       TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
NM_016828.2       TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
                  ************************************************************

HsCD00510107      CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
NM_002542.5       CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
NM_016819.3       CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
NM_016821.2       CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
NM_016829.2       CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
NM_016820.3       CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
NM_016828.2       CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
                  ************************************************************

HsCD00510107      GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
NM_002542.5       GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
NM_016819.3       GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
NM_016821.2       GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
NM_016829.2       GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
NM_016820.3       GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
NM_016828.2       GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
                  ************************************************************

HsCD00510107      TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
NM_002542.5       TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
NM_016819.3       TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
NM_016821.2       TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
NM_016829.2       TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
NM_016820.3       TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
NM_016828.2       TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
                  ************************************************************

HsCD00510107      AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
NM_002542.5       AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
NM_016819.3       AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
NM_016821.2       AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
NM_016829.2       AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
NM_016820.3       AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
NM_016828.2       AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
                  ************************************************************

HsCD00510107      TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
NM_002542.5       TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
NM_016819.3       TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
NM_016821.2       TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
NM_016829.2       TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
NM_016820.3       TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
NM_016828.2       TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
                  ************************************************************

HsCD00510107      AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGG-----------------CCC
NM_002542.5       AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGG-----------------GCCC
NM_016819.3       AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGG-----------
NM_016821.2       AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGGGCCTCCTTGGC
NM_016829.2       AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGGCTGGATCAGAT
NM_016820.3       AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGACTCCACCCTCC
NM_016828.2       AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGCTCTGTCAGGTC
                  ***************************************                     

HsCD00510107      AAGCGGTGCTGTTCAG--------------------------------------TGCCGA
NM_002542.5       AAGCGGTGCTGTTCAG--------------------------------------TGCCGA
NM_016819.3       ------------------------------------------------TGAGTGTACCTA
NM_016821.2       AATGCATTTGATGGCCACCAGCTTCTGCGTCCTCTTATCTTCTGCCAGGATCACCTCCGA
NM_016829.2       GCCTCCTGA---------------------------------------------------
NM_016820.3       TACAGGTGCTGTTCAG--------------------------------------TGCCGA
NM_016828.2       ATCACCACTTTTATG---------------------------------------ACCTTT
                                                                              

HsCD00510107      CCTGCGCCAATGCCGCCATGCTCAGGAGCCACCAGCAAAGCGCAGAAAGGGTTCCAAAGG
NM_002542.5       CCTGCGCCAATCCCGCCATGCTCAGGAGCCACCAGCAAAGCGCAGAAAGGGTTCCAAAGG
NM_016819.3       GGTGTCCTCCCTAG----------------------------------------------
NM_016821.2       GAAGGCCCCCCTATCGGGAGAGGGGATTCACAAGGTGAAGAACTGGAACCCCAGCTTCCC
NM_016829.2       ------------------------------------------------------------
NM_016820.3       CCTGCGCCAATCCCGCCATGCTCAGGAGCCACCAGCAAAGCGCAGAAAGGGTTCCAAAGG
NM_016828.2       CTCGGACCCCATAGGCTGGATCAGATGCCTCCTGAAGAATTACAG---------------
                                                                              

HsCD00510107      GCCGGAAGGC--------------------------------------------------
NM_002542.5       GCCGGAAGGCTAG-----------------------------------------------
NM_016819.3       ------------------------------------------------------------
NM_016821.2       TCCAGCCTCTCCTCCATTCCCTATGGGTTCTGTGACCACTGCTGGACCAAGGACGTGGAT
NM_016829.2       ------------------------------------------------------------
NM_016820.3       GCCGGAAGGCTAGATGGGGCACCCTGGACAAAGAAATTCCCCAAGCACCTTCCCCTCCAT
NM_016828.2       -----------------------------------------------------------A
                                                                              

HsCD00510107      ------------------------------------------------------------
NM_002542.5       ------------------------------------------------------------
NM_016819.3       ------------------------------------------------------------
NM_016821.2       GACCCTCCCCTAGTCACTCATCCATCCCCTGGCTCCAGAGATGGTCACATGACCCAGGCC
NM_016829.2       ------------------------------------------------------------
NM_016820.3       TCCCCACTTCTCTCTCCCCATCCCCACCCAGTCTCATGTTGGGGAGGGGCCTCCCTGTGA
NM_016828.2       CTTCTTCCTCTAGACTTGGAGGGCCTCCTTGGCAATGCATTTGA----------------
                                                                              

HsCD00510107      ------------------------------------------------------------
NM_002542.5       ------------------------------------------------------------
NM_016819.3       ------------------------------------------------------------
NM_016821.2       TGGCCAGTCAAAGTAGTCTCTCCCCTGGCCACAGTAATTGGTCATGTGATGCAAGCCAGC
NM_016829.2       ------------------------------------------------------------
NM_016820.3       CTACCTCAAAGGCCAGGCACCCCCAAATCAAGCAGTCAG---TTTGCACAACAAGATGGG
NM_016828.2       ------------------------------------------------------------
                                                                              

HsCD00510107      ---------------
NM_002542.5       ---------------
NM_016819.3       ---------------
NM_016821.2       TTACTAGCACTTTGA
NM_016829.2       ---------------
NM_016820.3       GTGGGGGATATTGA-
NM_016828.2       ---------------
                                 

Pathways

NCI : Validated transcriptional targets of TAp63 isoforms
Reactome : Base Excision Repair
Reactome : Base-Excision Repair, AP Site Formation
Reactome : Base-free sugar-phosphate removal via the single-nucleotide replacement pathway
Reactome : Cleavage of the damaged purine
Reactome : DNA Repair
Reactome : Depurination
Reactome : Displacement of DNA glycosylase by APE1
Reactome : Recognition and association of DNA glycosylase with site containing an affected purine
Reactome : Removal of DNA patch containing abasic residue
Reactome : Resolution of AP sites via the multiple-nucleotide patch replacement pathway
Reactome : Resolution of AP sites via the single-nucleotide replacement pathway
Reactome : Resolution of Abasic Sites (AP sites)

Protein

SMART domain : ENDO3c : endonuclease III
HPRD : 03582

Clone

Cloning Information : 609102
Original Clone ID : ccsbBroadEn_06670

Organism


TAX_ID : 9606
Species Specific ID: 4968

Genome

Chromosome : 3
Map Location : 3p26.2
Ensembl : ENSG00000114026

Reagents

Labome : OGG1-antibody