DNASU Plasmid Repository • 480.965.5697 | Email

GOT1 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GOT1
Gene Name:  glutamic-oxaloacetic transaminase 1, soluble
Sequence             
Original Clone ID: ccsbBroadEn_00665
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC000498.2
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00511382

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1240nts         Open reading frame : 1 to 1240
Reference Sequence Alignment

ATGGCACCTCCGTCAGTCTTTGCCGAGGTTCCGCAGGCCCAGCCTGTCCTGGTCTTCAAG
CTCACTGCCGACTTCAGGGAGGATCCGGACCCCCGCAAGGTCAACCTGGGAGTGGGAGCA
TATCGCACGGATGACTGCCATCCCTGGGTTTTGCCAGTAGTGAAGAAAGTGGAGCAGAAG
ATTGCTAATGACAATAGCCTAAATCACGAGTATCTGCCAATCCTGGGCCTGGCTGAGTTC
CGGAGCTGTGCTTCTCGTCTTGCCCTTGGGGATGACAGCCCAGCACTCAAGGAGAAGCGG
GTAGGAGGTGTGCAATCTTTGGGGGGAACAGGTGCACTTCGAATTGGAGCTGATTTCTTA
GCGCGTTGGTACAATGGAACAAACAACAAGAACACACCTGTCTATGTGTCCTCACCAACC
TGGGAGAATCACAATGCTGTGTTTTCCGCTGCTGGTTTTAAAGACATTCGGTCCTATCGC
TACTGGGATGCAGAGAAGAGAGGATTGGACCTCCAGGGCTTCCTGAATGATCTGGAGAAT
GCTCCTGAGTTCTCCATTGTTGTCCTCCACGCCTGTGCACACAACCCAACTGGGATTGAC
CCAACTCCGGAGCAGTGGAAGCAGATTGCTTCTGTCATGAAGCACCGGTTTCTGTTCCCC
TTCTTTGACTCAGCCTATCAGGGCTTCGCATCTGGAAACCTGGAGAGAGATGCCTGGGCC
ATTCGCTATTTTGTGTCTGAAGGCTTCGAGTTCTTCTGTGCCCAGTCCTTCTCCAAGAAC
TTCGGGCTCTACAATGAGAGAGTCGGGAATCTGACTGTGGTTGGAAAAGAACCTGAGAGC
ATCCTGCAAGTCCTTTCCCAGATGGAGAAGATCGTGCGGATTACTTGGTCCAATCCCCCC
GCCCAGGGAGCACGAATTGTGGCCAGCACCCTCTCTAACCCTGAGCTCTTTGAGGAATGG
ACAGGTAATGTGAAGACAATGGCTGACCGGATTCTGACCATGAGATCTGAACTCAGGGCA
CGACTAGAAGCCCTCAAAACCCCTGGGACCTGGAACCACATCACTGATCAAATTGGCATG
TTCAGCTTCACTGGGTTGAACCCCAAGCAGGTTGAGTATCTGGTCAATGAAAAGCACATC
TACCTGCTGCCAAGTGGTCGAATCAACGTGAGTGGCTTAACCACCAAAAATCTAGATTAC
GTGGCCACCTCCATCCATGAAGCAGTCACCAAAATCCAG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GOT1
Symbol Nomenclature : GOT1
SYNONYM : ASTQTL1; GIG18; cAspAT; cCAT
Designation : aspartate aminotransferase 1|aspartate aminotransferase, cytoplasmic|aspartate transaminase 1|cysteine aminotransferase, cytoplasmic|cysteine transaminase, cytoplasmic|glutamate oxaloacetate transaminase 1|growth-inhibiting protein 18|transaminase A
Full Nomenclature : glutamic-oxaloacetic transaminase 1, soluble
GENEID : 2805
HGNC : 4432
MIM : 138180
Vega : OTTHUMG00000018882
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00511382      ATGGCACCTCCGTCAGTCTTTGCCGAGGTTCCGCAGGCCCAGCCTGTCCTGGTCTTCAAG
NM_002079.2       ATGGCACCTCCGTCAGTCTTTGCCGAGGTTCCGCAGGCCCAGCCTGTCCTGGTCTTCAAG
                  ************************************************************

HsCD00511382      CTCACTGCCGACTTCAGGGAGGATCCGGACCCCCGCAAGGTCAACCTGGGAGTGGGAGCA
NM_002079.2       CTCACTGCCGACTTCAGGGAGGATCCGGACCCCCGCAAGGTCAACCTGGGAGTGGGAGCA
                  ************************************************************

HsCD00511382      TATCGCACGGATGACTGCCATCCCTGGGTTTTGCCAGTAGTGAAGAAAGTGGAGCAGAAG
NM_002079.2       TATCGCACGGATGACTGCCATCCCTGGGTTTTGCCAGTAGTGAAGAAAGTGGAGCAGAAG
                  ************************************************************

HsCD00511382      ATTGCTAATGACAATAGCCTAAATCACGAGTATCTGCCAATCCTGGGCCTGGCTGAGTTC
NM_002079.2       ATTGCTAATGACAATAGCCTAAATCACGAGTATCTGCCAATCCTGGGCCTGGCTGAGTTC
                  ************************************************************

HsCD00511382      CGGAGCTGTGCTTCTCGTCTTGCCCTTGGGGATGACAGCCCAGCACTCAAGGAGAAGCGG
NM_002079.2       CGGAGCTGTGCTTCTCGTCTTGCCCTTGGGGATGACAGCCCAGCACTCAAGGAGAAGCGG
                  ************************************************************

HsCD00511382      GTAGGAGGTGTGCAATCTTTGGGGGGAACAGGTGCACTTCGAATTGGAGCTGATTTCTTA
NM_002079.2       GTAGGAGGTGTGCAATCTTTGGGGGGAACAGGTGCACTTCGAATTGGAGCTGATTTCTTA
                  ************************************************************

HsCD00511382      GCGCGTTGGTACAATGGAACAAACAACAAGAACACACCTGTCTATGTGTCCTCACCAACC
NM_002079.2       GCGCGTTGGTACAATGGAACAAACAACAAGAACACACCTGTCTATGTGTCCTCACCAACC
                  ************************************************************

HsCD00511382      TGGGAGAATCACAATGCTGTGTTTTCCGCTGCTGGTTTTAAAGACATTCGGTCCTATCGC
NM_002079.2       TGGGAGAATCACAATGCTGTGTTTTCCGCTGCTGGTTTTAAAGACATTCGGTCCTATCGC
                  ************************************************************

HsCD00511382      TACTGGGATGCAGAGAAGAGAGGATTGGACCTCCAGGGCTTCCTGAATGATCTGGAGAAT
NM_002079.2       TACTGGGATGCAGAGAAGAGAGGATTGGACCTCCAGGGCTTCCTGAATGATCTGGAGAAT
                  ************************************************************

HsCD00511382      GCTCCTGAGTTCTCCATTGTTGTCCTCCACGCCTGTGCACACAACCCAACTGGGATTGAC
NM_002079.2       GCTCCTGAGTTCTCCATTGTTGTCCTCCACGCCTGTGCACACAACCCAACTGGGATTGAC
                  ************************************************************

HsCD00511382      CCAACTCCGGAGCAGTGGAAGCAGATTGCTTCTGTCATGAAGCACCGGTTTCTGTTCCCC
NM_002079.2       CCAACTCCGGAGCAGTGGAAGCAGATTGCTTCTGTCATGAAGCACCGGTTTCTGTTCCCC
                  ************************************************************

HsCD00511382      TTCTTTGACTCAGCCTATCAGGGCTTCGCATCTGGAAACCTGGAGAGAGATGCCTGGGCC
NM_002079.2       TTCTTTGACTCAGCCTATCAGGGCTTCGCATCTGGAAACCTGGAGAGAGATGCCTGGGCC
                  ************************************************************

HsCD00511382      ATTCGCTATTTTGTGTCTGAAGGCTTCGAGTTCTTCTGTGCCCAGTCCTTCTCCAAGAAC
NM_002079.2       ATTCGCTATTTTGTGTCTGAAGGCTTCGAGTTCTTCTGTGCCCAGTCCTTCTCCAAGAAC
                  ************************************************************

HsCD00511382      TTCGGGCTCTACAATGAGAGAGTCGGGAATCTGACTGTGGTTGGAAAAGAACCTGAGAGC
NM_002079.2       TTCGGGCTCTACAATGAGAGAGTCGGGAATCTGACTGTGGTTGGAAAAGAACCTGAGAGC
                  ************************************************************

HsCD00511382      ATCCTGCAAGTCCTTTCCCAGATGGAGAAGATCGTGCGGATTACTTGGTCCAATCCCCCC
NM_002079.2       ATCCTGCAAGTCCTTTCCCAGATGGAGAAGATCGTGCGGATTACTTGGTCCAATCCCCCC
                  ************************************************************

HsCD00511382      GCCCAGGGAGCACGAATTGTGGCCAGCACCCTCTCTAACCCTGAGCTCTTTGAGGAATGG
NM_002079.2       GCCCAGGGAGCACGAATTGTGGCCAGCACCCTCTCTAACCCTGAGCTCTTTGAGGAATGG
                  ************************************************************

HsCD00511382      ACAGGTAATGTGAAGACAATGGCTGACCGGATTCTGACCATGAGATCTGAACTCAGGGCA
NM_002079.2       ACAGGTAATGTGAAGACAATGGCTGACCGGATTCTGACCATGAGATCTGAACTCAGGGCA
                  ************************************************************

HsCD00511382      CGACTAGAAGCCCTCAAAACCCCTGGGACCTGGAACCACATCACTGATCAAATTGGCATG
NM_002079.2       CGACTAGAAGCCCTCAAAACCCCTGGGACCTGGAACCACATCACTGATCAAATTGGCATG
                  ************************************************************

HsCD00511382      TTCAGCTTCACTGGGTTGAACCCCAAGCAGGTTGAGTATCTGGTCAATGAAAAGCACATC
NM_002079.2       TTCAGCTTCACTGGGTTGAACCCCAAGCAGGTTGAGTATCTGGTCAATGAAAAGCACATC
                  ************************************************************

HsCD00511382      TACCTGCTGCCAAGTGGTCGAATCAACGTGAGTGGCTTAACCACCAAAAATCTAGATTAC
NM_002079.2       TACCTGCTGCCAAGTGGTCGAATCAACGTGAGTGGCTTAACCACCAAAAATCTAGATTAC
                  ************************************************************

HsCD00511382      GTGGCCACCTCCATCCATGAAGCAGTCACCAAAATCCAG---
NM_002079.2       GTGGCCACCTCCATCCATGAAGCAGTCACCAAAATCCAGTGA
                  ***************************************   

Pathways

Panther : Asparagine and aspartate biosynthesis
Reactome : Amino acid synthesis and interconversion (transamination)
Reactome : Disease
Reactome : Gluconeogenesis
Reactome : Glucose metabolism
Reactome : Glycogen storage diseases
Reactome : Metabolism
Reactome : Metabolism of amino acids and derivatives
Reactome : Metabolism of carbohydrates
Reactome : Metabolism of polyamines
Reactome : Methionine salvage pathway
Reactome : Myoclonic epilepsy of Lafora
Reactome : Sulfur amino acid metabolism
WikiPathway : Alanine and aspartate metabolism
WikiPathway : Glycolysis and Gluconeogenesis

Protein

HPRD : 00687

Clone

Cloning Information : 669323
Original Clone ID : ccsbBroadEn_00665

Organism


TAX_ID : 9606
Species Specific ID: 2805

Genome

Chromosome : 10
Map Location : 10q24.1-q25.1
Ensembl : ENSG00000120053

Reagents

Labome : GOT1-antibody