DNASU Plasmid Repository • 480.965.5697 | Email

ZBP1 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ZBP1
Gene Name:  Z-DNA binding protein 1
Sequence             
Original Clone ID: ccsbBroadEn_09057
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC131706.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00511503

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1288nts         Open reading frame : 1 to 1288
Reference Sequence Alignment

ATGGCCCAGGCTCCTGCTGACCCGGGCAGAGAAGGCCACCTTGAACAAAGAATCCTGCAG
GTGCTGACAGAGGCTGGCTCCCCGGTGAAACTTGCCCAGCTGGTGAAGGAATGCCAAGCA
CCCAAGAGGGAGCTCAACCAAGTCCTCTACCGAATGAAAAAGGAGTTGAAAGTCTCCCTC
ACATCCCCTGCCACCTGGTGCTTGGGCGGGACTGATCCTGAAGGCGAGGGTCCTGCAGAG
CTGGCCTTGTCCAGCCCTGCCAAGAGGCCCCAGCAACATGCAGCTACAATTCCAGAGACC
CCTGGCCCTCAGTTCAGCCAACAACGGGAGGAAGACATCTACAGGTTTCTCAAAGACAAT
GGTCCCCAGAGGGCCCTGGTCATCGCCCAAGCACTGGGAATGAGGACAGCAAAAGATGTG
AACCGAGACTTGTACAGGATGAAGAGCAGGCACCTTCTGGACATGGATGAGCAGTCCAAA
GCATGGACGATTTACCGCCCAGAAGATTCTGGAAGAAGAGCAAAGTCAGCCTCAATTATT
TACCAGCACAATCCAATCAACATGATCTGCCAGAATGGACCCAACAGCTGGATTTCCATT
GCAAACTCCGAAGCCATCCAGATTGGACACGGGAACATCATTACAAGACAGACAGTCTCC
AGGGAGGACGGTTCCGCCGGTCCACGCCACCTCCCTTCAATGGCACCAGGTGATTCCTCA
ACTTGGGGGACCCTAGTTGATCCCTGGGGGCCCCAGGACATCCACATGGAGCGGTCCATA
CTGAGACGGGTGCAGCTGGGACACAGCAATGAGATGAGGCTCCACGGCGTCCCGTCCGAG
GGCCCTGCCCACATCCCCCCTGGCAGCCCCCCAGTCTCTGCCACTGCTGCCGGCCCAGAA
GCTTCGTTTGAAGCAAGAATTCCCAGTCCAGGAACTCACCCTGAGGGGGAAGCCGCCCAG
AGAATCCACATGAAATCGTGCTTTCTCGAGGACGCCACCATCGGCAACAGCAACAAAATG
TCTATCAGCCCAGGGGTGGCTGGCCCAGGAGGAGTCGCAGGGTCTGGAGAGGGGGAGCCA
GGGGAGGACGCAGGTCGTCGTCCCGCAGACACACAATCCAGAAGTCACTTTCCTCGAGAC
ATTGGTCAGCCCATCACTCCCAGCCACTCGAAGCTCACCCCCAAGCTGGAAACTATGACT
CTTGGAAACAGGAGTCACAAAGCTGCAGAAGGCAGCCACTATGTGGATGAAGCCTCACAC
GAGGGGAGCTGGTGGGGAGGTGGGATT


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ZBP1
Symbol Nomenclature : ZBP1
SYNONYM : C20orf183; DAI; DLM-1; DLM1
Designation : DNA-dependent activator of IFN-regulatory factors|DNA-dependent activator of IRFs|DNA-dependent activator of interferon regulatory factors|Z-DNA-binding protein 1|tumor stroma and activated macrophage protein DLM-1
Full Nomenclature : Z-DNA binding protein 1
GENEID : 81030
Locus Tag : RP4-718J7.1
HGNC : 16176
MIM : 606750
Vega : OTTHUMG00000032824
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00511503        ATGGCCCAGGCTCCTGCTGACCCGGGCAGAGAAGGCCACCTTGAACAAAGAATCCTGCAG
NM_030776.2         ATGGCCCAGGCTCCTGCTGACCCGGGCAGAGAAGGCCACCTTGAACAAAGAATCCTGCAG
NM_001160417.1      ATGGCCCAGGCTCCTGCTGACCCGGGCAGAGAAGGCCACCTTGAACAAAGAATCCTGCAG
                    ************************************************************

HsCD00511503        GTGCTGACAGAGGCTGGCTCCCCGGTGAAACTTGCCCAGCTGGTGAAGGAATGCCAAGCA
NM_030776.2         GTGCTGACAGAGGCTGGCTCCCCGGTGAAACTTGCCCAGCTGGTGAAGGAATGCCAAGCA
NM_001160417.1      GTGCTGACAGAGGCTGGCTCCCCGGTGAAACTTGCCCAGCTGGTGAAGGAATGCCAAGCA
                    ************************************************************

HsCD00511503        CCCAAGAGGGAGCTCAACCAAGTCCTCTACCGAATGAAAAAGGAGTTGAAAGTCTCCCTC
NM_030776.2         CCCAAGAGGGAGCTCAACCAAGTCCTCTACCGAATGAAAAAGGAGTTGAAAGTCTCCCTC
NM_001160417.1      CCCAAGAGGGAGCTCAACCAAGTCCTCTACCGAATGAAAAAGGAGTTGAAAGTCTCCCTC
                    ************************************************************

HsCD00511503        ACATCCCCTGCCACCTGGTGCTTGGGCGGGACTGATCCTGAAGGCGAGGGTCCTGCAGAG
NM_030776.2         ACATCCCCTGCCACCTGGTGCTTGGGCGGGACTGATCCTGAAGGCGAGGGTCCTGCAGAG
NM_001160417.1      ACATCCCCTGCCACCTGGTGCTTGGGCGGGACTGATCCTGAAGGCGAGGGTCCTGCAGAG
                    ************************************************************

HsCD00511503        CTGGCCTTGTCCAGCCCTGCCAAGAGGCCCCAGCAACATGCAGCTACAATTCCAGAGACC
NM_030776.2         CTGGCCTTGTCCAGCCCTGCCGAGAGGCCCCAGCAACATGCAGCTACAATTCCAGAGACC
NM_001160417.1      CTGGCCTTGTCCAGCCCTGCCGAGAGGCCCCAGCAACATGCAGCTACAATTCCAGAGACC
                    *********************.**************************************

HsCD00511503        CCTGGCCCTCAGTTCAGCCAACAACGGGAGGAAGACATCTACAGGTTTCTCAAAGACAAT
NM_030776.2         CCTGGCCCTCAGTTCAGCCAACAACGGGAGGAAGACATCTACAGGTTTCTCAAAGACAAT
NM_001160417.1      CCTGGCCCTCAGTTCAGCCAACAACGGGAGGAAGACATCTACAGGTTTCTCAAAGACAAT
                    ************************************************************

HsCD00511503        GGTCCCCAGAGGGCCCTGGTCATCGCCCAAGCACTGGGAATGAGGACAGCAAAAGATGTG
NM_030776.2         GGTCCCCAGAGGGCCCTGGTCATCGCCCAAGCACTGGGAATGAGGACAGCAAAAGATGTG
NM_001160417.1      GGTCCCCAGAGGGCCCTGGTCATCGCCCAAGCACTGGGAATGAGGACAGCAAAAGATGTG
                    ************************************************************

HsCD00511503        AACCGAGACTTGTACAGGATGAAGAGCAGGCACCTTCTGGACATGGATGAGCAGTCCAAA
NM_030776.2         AACCGAGACTTGTACAGGATGAAGAGCAGGCACCTTCTGGACATGGATGAGCAGTCCAAA
NM_001160417.1      AACCGAGACTTGTACAGGATGAAGAGCAGGCACCTTCTGGACATGGATGAGCAGTCCAAA
                    ************************************************************

HsCD00511503        GCATGGACGATTTACCGCCCAGAAGATTCTGGAAGAAGAGCAAAGTCAGCCTCAATTATT
NM_030776.2         GCATGGACGATTTACCGCCCAGAAGATTCTGGAAGAAGAGCAAAGTCAGCCTCAATTATT
NM_001160417.1      GCATGGACGATTTACCGCCCAGAT---TCTGGAAGAAGAGCAAAGTCAGCCTCAATTATT
                    ***********************:   *********************************

HsCD00511503        TACCAGCACAATCCAATCAACATGATCTGCCAGAATGGACCCAACAGCTGGATTTCCATT
NM_030776.2         TACCAGCACAATCCAATCAACATGATCTGCCAGAATGGACCCAACAGCTGGATTTCCATT
NM_001160417.1      TACCAGCACAATCCAATCAACATGATCTGCCAGAATGGACCCAACAGCTGGATTTCCATT
                    ************************************************************

HsCD00511503        GCAAACTCCGAAGCCATCCAGATTGGACACGGGAACATCATTACAAGACAGACAGTCTCC
NM_030776.2         GCAAACTCCGAAGCCATCCAGATTGGACACGGGAACATCATTACAAGACAGACAGTCTCC
NM_001160417.1      GCAAACTCCGAAGCCATCCAGATTGGACACGGGAACATCATTACAAGACAGACAGTCTCC
                    ************************************************************

HsCD00511503        AGGGAGGACGGTTCCGCCGGTCCACGCCACCTCCCTTCAATGGCACCAGGTGATTCCTCA
NM_030776.2         AGGGAGGACGGTTCCGCCGGTCCACGCCACCTCCCTTCAATGGCACCAGGTGATTCCTCA
NM_001160417.1      AGGGAGGACGGTTCCGCCGGTCCACGCCACCTCCCTTCAATGGCACCAGGTGATTCCTCA
                    ************************************************************

HsCD00511503        ACTTGGGGGACCCTAGTTGATCCCTGGGGGCCCCAGGACATCCACATGGAGCGGTCCATA
NM_030776.2         ACTTGGGGGACCCTAGTTGATCCCTGGGGGCCCCAGGACATCCACATGGAGCAGTCCATA
NM_001160417.1      ACTTGGGGGACCCTAGTTGATCCCTGGGGGCCCCAGGACATCCACATGGAGCAGTCCATA
                    ****************************************************.*******

HsCD00511503        CTGAGACGGGTGCAGCTGGGACACAGCAATGAGATGAGGCTCCACGGCGTCCCGTCCGAG
NM_030776.2         CTGAGACGGGTGCAGCTGGGACACAGCAATGAGATGAGGCTCCACGGCGTCCCGTCCGAG
NM_001160417.1      CTGAGACGGGTGCAGCTGGGACACAGCAATGAGATGAGGCTCCACGGCGTCCCGTCCGAG
                    ************************************************************

HsCD00511503        GGCCCTGCCCACATCCCCCCTGGCAGCCCCCCAGTCTCTGCCACTGCTGCCGGCCCAGAA
NM_030776.2         GGCCCTGCCCACATCCCCCCTGGCAGCCCCCCAGTCTCTGCCACTGCTGCCGGCCCAGAA
NM_001160417.1      GGCCCTGCCCACATCCCCCCTGGCAGCCCCCCAGTCTCTGCCACTGCTGCCGGCCCAGAA
                    ************************************************************

HsCD00511503        GCTTCGTTTGAAGCAAGAATTCCCAGTCCAGGAACTCACCCTGAGGGGGAAGCCGCCCAG
NM_030776.2         GCTTCGTTTGAAGCAAGAATTCCCAGTCCAGGAACTCACCCTGAGGGGGAAGCCGCCCAG
NM_001160417.1      GCTTCGTTTGAAGCAAGAATTCCCAGTCCAGGAACTCACCCTGAGGGGGAAGCCGCCCAG
                    ************************************************************

HsCD00511503        AGAATCCACATGAAATCGTGCTTTCTCGAGGACGCCACCATCGGCAACAGCAACAAAATG
NM_030776.2         AGAATCCACATGAAATCGTGCTTTCTCGAGGACGCCACCATCGGCAACAGCAACAAAATG
NM_001160417.1      AGAATCCACATGAAATCGTGCTTTCTCGAGGACGCCACCATCGGCAACAGCAACAAAATG
                    ************************************************************

HsCD00511503        TCTATCAGCCCAGGGGTGGCTGGCCCAGGAGGAGTCGCAGGGTCTGGAGAGGGGGAGCCA
NM_030776.2         TCTATCAGCCCAGGGGTGGCTGGCCCAGGAGGAGTCGCAGGGTCTGGAGAGGGGGAGCCA
NM_001160417.1      TCTATCAGCCCAGGGGTGGCTGGCCCAGGAGGAGTCGCAGGGTCTGGAGAGGGGGAGCCA
                    ************************************************************

HsCD00511503        GGGGAGGACGCAGGTCGTCGTCCCGCAGACACACAATCCAGAAGTCACTTTCCTCGAGAC
NM_030776.2         GGGGAGGACGCAGGTCGTCGTCCCGCAGACACACAATCCAGAAGTCACTTTCCTCGAGAC
NM_001160417.1      GGGGAGGACGCAGGTCGTCGTCCCGCAGACACACAATCCAGAAGTCACTTTCCTCGAGAC
                    ************************************************************

HsCD00511503        ATTGGTCAGCCCATCACTCCCAGCCACTCGAAGCTCACCCCCAAGCTGGAAACTATGACT
NM_030776.2         ATTGGTCAGCCCATCACTCCCAGCCACTCGAAGCTCACCCCCAAGCTGGAAACTATGACT
NM_001160417.1      ATTGGTCAGCCCATCACTCCCAGCCACTCGAAGCTCACCCCCAAGCTGGAAACTATGACT
                    ************************************************************

HsCD00511503        CTTGGAAACAGGAGTCACAAAGCTGCAGAAGGCAGCCACTATGTGGATGAAGCCTCACAC
NM_030776.2         CTTGGAAACAGGAGTCACAAAGCTGCAGAAGGCAGCCACTATGTGGATGAAGCCTCACAC
NM_001160417.1      CTTGGAAACAGGAGTCACAAAGCTGCAGAAGGCAGCCACTATGTGGATGAAGCCTCACAC
                    ************************************************************

HsCD00511503        GAGGGGAGCTGGTGGGGAGGTGGGATT---
NM_030776.2         GAGGGGAGCTGGTGGGGAGGTGGGATTTAG
NM_001160417.1      GAGGGGAGCTGGTGGGGAGGTGGGATTTAG
                    ***************************   

Pathways

Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : IRF3 mediated activation of type 1 IFN
Reactome : IRF3-mediated induction of type I IFN
Reactome : Immune System
Reactome : Innate Immune System
Reactome : RIP-mediated NFkB activation via ZBP1
Reactome : Regulation of innate immune responses to cytosolic DNA
Reactome : STING mediated induction of host immune responses
Reactome : ZBP1(DAI) mediated induction of type I IFNs

Clone

Cloning Information : 669403
Original Clone ID : ccsbBroadEn_09057

Organism


TAX_ID : 9606
Species Specific ID: 81030

Genome

Chromosome : 20
Map Location : 20q13.31
Ensembl : ENSG00000124256

Reagents

Labome : DLM-1-antibody