DNASU Plasmid Repository • 480.965.5697 | Email

CYP19A1 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CYP19A1
Gene Name:  cytochrome P450, family 19, subfamily A, polypeptide 1
Sequence             
Original Clone ID: ccsbBroadEn_06078
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC035959.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00512497

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1510nts         Open reading frame : 1 to 1510
Reference Sequence Alignment

ATGGTTTTGGAAATGCTGAACCCGATACATTATAACATCACCAGCATCGTGCCTGAAGCC
ATGCCTGCTGCCACCATGCCAGTCCTGCTCCTCACTGGCCTTTTTCTCTTGGTGTGGAAT
TATGAGGGCACATCCTCAATACCAGGTCCTGGCTACTGCATGGGAATTGGACCCCTCATC
TCCCACGGCAGATTCCTGTGGATGGGGATCGGCAGTGCCTGCAACTACTACAACCGGGTG
TATGGAGAATTCATGCGAGTCTGGATCTCTGGAGAGGAAACACTCATTATCAGCAAGTCC
TCAAGTATGTTCCACATAATGAAGCACAATCATTACAGCTCTCGATTCGGCAGCAAACTT
GGGCTGCAGTGCATCGGTATGCATGAGAAAGGCATCATATTTAACAACAATCCAGAGCTC
TGGAAAACAACTCGACCCTTCTTTATGAAAGCTCTGTCAGGCCCCGGCCTTGTTCGTATG
GTCACAGTCTGTGCTGAATCCCTCAAAACACATCTGGACAGGTTGGAGGAGGTGACCAAT
GAATCGGGCTATGTGGACGTGTTGACCCTTCTGCGTCGTGTCATGCTGGACACCTCTAAC
ACGCTCTTCTTGAGGATCTCTTTGGACGAAAGTGCTATCGTGGTTAAAATCCAAGGTTAT
TTTGATGCATGGCAAGCTCTCCTCATCAAACCAGACATCTTCTTTAAGATTTCTTGGCTA
TACAAAAAGTATGAGAAGTCTGTCAAGGATTTGAAAGATGCCATAGAAGTTCTGATAGCA
GAAAAAAGACGCAGGATTTCCACAGAAGAGAAACTGGAAGAATGTATGGACTTTGCCACT
GAGTTGATTTTAGCAGAGAAACGTGGTGACCTGACAAGAGAGAATGTGAACCAGTGCATA
TTGGAAATGCTGATCGCAGCTCCTGACACCATGTCTGTCTCTTTGTTCTTCATGCTATTT
CTCATTGCAAAGCACCCTAATGTTGAAGAGGCAATAATAAAGGAAATCCAGACTGTTATT
GGTGAGAGAGACATAAAGATTGATGATATACAAAAATTAAAAGTGATGGAAAACTTCATT
TATGAGAGCATGCGGTACCAGCCTGTCGTGGACTTGGTCATGCGCAAAGCCTTAGAAGAT
GATGTAATCGATGGCTACCCAGTGAAAAAGGGGACAAACATTATCCTGAATATTGGAAGG
ATGCACAGACTCGAGTTTTTCCCCAAACCCAATGAATTTACTCTTGAAAATTTTGCAAAG
AATGTTCCTTATAGGTACTTTCAGCCATTTGGCTTTGGGCCCCGTGGCTGTGCAGGAAAG
TACATCGCCATGGTGATGATGAAAGCCATCCTCGTTACACTTCTGAGACGATTCCACGTG
AAGACATTGCAAGGACAGTGTGTTGAGAGCATACAGAAGATACACGACTTGTCCTTGCAC
CCAGATGAGACTAAAAACATGCTGGAAATGATCTTTACCCCAAGAAACTCAGACAGGTGT
CTGGAACAC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CYP19A1
Symbol Nomenclature : CYP19A1
SYNONYM : ARO; ARO1; CPV1; CYAR; CYP19; CYPXIX; P-450AROM
Designation : aromatase|cytochrome P-450AROM|cytochrome P450 19A1|cytochrome P450, subfamily XIX (aromatization of androgens)|estrogen synthase|estrogen synthetase|flavoprotein-linked monooxygenase|microsomal monooxygenase
Full Nomenclature : cytochrome P450, family 19, subfamily A, polypeptide 1
GENEID : 1588
GenBank Accession : AM393184
HGNC : 2594
MIM : 107910
Vega : OTTHUMG00000131747
Target GenBank: AM393184

 

Reference Sequence Alignment

  

HsCD00512497        ATGGTTTTGGAAATGCTGAACCCGATACATTATAACATCACCAGCATCGTGCCTGAAGCC
NM_031226.2         ATGGTTTTGGAAATGCTGAACCCGATACATTATAACATCACCAGCATCGTGCCTGAAGCC
XM_005254190.1      ATGGTTTTGGAAATGCTGAACCCGATACATTATAACATCACCAGCATCGTGCCTGAAGCC
XM_005254191.1      ATGGTTTTGGAAATGCTGAACCCGATACATTATAACATCACCAGCATCGTGCCTGAAGCC
NM_000103.3         ATGGTTTTGGAAATGCTGAACCCGATACATTATAACATCACCAGCATCGTGCCTGAAGCC
                    ************************************************************

HsCD00512497        ATGCCTGCTGCCACCATGCCAGTCCTGCTCCTCACTGGCCTTTTTCTCTTGGTGTGGAAT
NM_031226.2         ATGCCTGCTGCCACCATGCCAGTCCTGCTCCTCACTGGCCTTTTTCTCTTGGTGTGGAAT
XM_005254190.1      ATGCCTGCTGCCACCATGCCAGTCCTGCTCCTCACTGGCCTTTTTCTCTTGGTGTGGAAT
XM_005254191.1      ATGCCTGCTGCCACCATGCCAGTCCTGCTCCTCACTGGCCTTTTTCTCTTGGTGTGGAAT
NM_000103.3         ATGCCTGCTGCCACCATGCCAGTCCTGCTCCTCACTGGCCTTTTTCTCTTGGTGTGGAAT
                    ************************************************************

HsCD00512497        TATGAGGGCACATCCTCAATACCAGGTCCTGGCTACTGCATGGGAATTGGACCCCTCATC
NM_031226.2         TATGAGGGCACATCCTCAATACCAGGTCCTGGCTACTGCATGGGAATTGGACCCCTCATC
XM_005254190.1      TATGAGGGCACATCCTCAATACCAGGTCCTGGCTACTGCATGGGAATTGGACCCCTCATC
XM_005254191.1      TATGAGGGCACATCCTCAATACCAGGTCCTGGCTACTGCATGGGAATTGGACCCCTCATC
NM_000103.3         TATGAGGGCACATCCTCAATACCAGGTCCTGGCTACTGCATGGGAATTGGACCCCTCATC
                    ************************************************************

HsCD00512497        TCCCACGGCAGATTCCTGTGGATGGGGATCGGCAGTGCCTGCAACTACTACAACCGGGTG
NM_031226.2         TCCCACGGCAGATTCCTGTGGATGGGGATCGGCAGTGCCTGCAACTACTACAACCGGGTA
XM_005254190.1      TCCCACGGCAGATTCCTGTGGATGGGGATCGGCAGTGCCTGCAACTACTACAACCGGGTA
XM_005254191.1      TCCCACGGCAGATTCCTGTGGATGGGGATCGGCAGTGCCTGCAACTACTACAACCGGGTA
NM_000103.3         TCCCACGGCAGATTCCTGTGGATGGGGATCGGCAGTGCCTGCAACTACTACAACCGGGTA
                    ***********************************************************.

HsCD00512497        TATGGAGAATTCATGCGAGTCTGGATCTCTGGAGAGGAAACACTCATTATCAGCAAGTCC
NM_031226.2         TATGGAGAATTCATGCGAGTCTGGATCTCTGGAGAGGAAACACTCATTATCAGCAAGTCC
XM_005254190.1      TATGGAGAATTCATGCGAGTCTGGATCTCTGGAGAGGAAACACTCATTATCAGCAAGTCC
XM_005254191.1      TATGGAGAATTCATGCGAGTCTGGATCTCTGGAGAGGAAACACTCATTATCAGCAAGTCC
NM_000103.3         TATGGAGAATTCATGCGAGTCTGGATCTCTGGAGAGGAAACACTCATTATCAGCAAGTCC
                    ************************************************************

HsCD00512497        TCAAGTATGTTCCACATAATGAAGCACAATCATTACAGCTCTCGATTCGGCAGCAAACTT
NM_031226.2         TCAAGTATGTTCCACATAATGAAGCACAATCATTACAGCTCTCGATTCGGCAGCAAACTT
XM_005254190.1      TCAAGTATGTTCCACATAATGAAGCACAATCATTACAGCTCTCGATTCGGCAGCAAACTT
XM_005254191.1      TCAAGTATGTTCCACATAATGAAGCACAATCATTACAGCTCTCGATTCGGCAGCAAACTT
NM_000103.3         TCAAGTATGTTCCACATAATGAAGCACAATCATTACAGCTCTCGATTCGGCAGCAAACTT
                    ************************************************************

HsCD00512497        GGGCTGCAGTGCATCGGTATGCATGAGAAAGGCATCATATTTAACAACAATCCAGAGCTC
NM_031226.2         GGGCTGCAGTGCATCGGTATGCATGAGAAAGGCATCATATTTAACAACAATCCAGAGCTC
XM_005254190.1      GGGCTGCAGTGCATCGGTATGCATGAGAAAGGCATCATATTTAACAACAATCCAGAGCTC
XM_005254191.1      GGGCTGCAGTGCATCGGTATGCATGAGAAAGGCATCATATTTAACAACAATCCAGAGCTC
NM_000103.3         GGGCTGCAGTGCATCGGTATGCATGAGAAAGGCATCATATTTAACAACAATCCAGAGCTC
                    ************************************************************

HsCD00512497        TGGAAAACAACTCGACCCTTCTTTATGAAAGCTCTGTCAGGCCCCGGCCTTGTTCGTATG
NM_031226.2         TGGAAAACAACTCGACCCTTCTTTATGAAAGCTCTGTCAGGCCCCGGCCTTGTTCGTATG
XM_005254190.1      TGGAAAACAACTCGACCCTTCTTTATGAAAGCTCTGTCAGGCCCCGGCCTTGTTCGTATG
XM_005254191.1      TGGAAAACAACTCGACCCTTCTTTATGAAAGCTCTGTCAGGCCCCGGCCTTGTTCGTATG
NM_000103.3         TGGAAAACAACTCGACCCTTCTTTATGAAAGCTCTGTCAGGCCCCGGCCTTGTTCGTATG
                    ************************************************************

HsCD00512497        GTCACAGTCTGTGCTGAATCCCTCAAAACACATCTGGACAGGTTGGAGGAGGTGACCAAT
NM_031226.2         GTCACAGTCTGTGCTGAATCCCTCAAAACACATCTGGACAGGTTGGAGGAGGTGACCAAT
XM_005254190.1      GTCACAGTCTGTGCTGAATCCCTCAAAACACATCTGGACAGGTTGGAGGAGGTGACCAAT
XM_005254191.1      GTCACAGTCTGTGCTGAATCCCTCAAAACACATCTGGACAGGTTGGAGGAGGTGACCAAT
NM_000103.3         GTCACAGTCTGTGCTGAATCCCTCAAAACACATCTGGACAGGTTGGAGGAGGTGACCAAT
                    ************************************************************

HsCD00512497        GAATCGGGCTATGTGGACGTGTTGACCCTTCTGCGTCGTGTCATGCTGGACACCTCTAAC
NM_031226.2         GAATCGGGCTATGTGGACGTGTTGACCCTTCTGCGTCGTGTCATGCTGGACACCTCTAAC
XM_005254190.1      GAATCGGGCTATGTGGACGTGTTGACCCTTCTGCGTCGTGTCATGCTGGACACCTCTAAC
XM_005254191.1      GAATCGGGCTATGTGGACGTGTTGACCCTTCTGCGTCGTGTCATGCTGGACACCTCTAAC
NM_000103.3         GAATCGGGCTATGTGGACGTGTTGACCCTTCTGCGTCGTGTCATGCTGGACACCTCTAAC
                    ************************************************************

HsCD00512497        ACGCTCTTCTTGAGGATCTCTTTGGACGAAAGTGCTATCGTGGTTAAAATCCAAGGTTAT
NM_031226.2         ACGCTCTTCTTGAGGATCCCTTTGGACGAAAGTGCTATCGTGGTTAAAATCCAAGGTTAT
XM_005254190.1      ACGCTCTTCTTGAGGATCCCTTTGGACGAAAGTGCTATCGTGGTTAAAATCCAAGGTTAT
XM_005254191.1      ACGCTCTTCTTGAGGATCCCTTTGGACGAAAGTGCTATCGTGGTTAAAATCCAAGGTTAT
NM_000103.3         ACGCTCTTCTTGAGGATCCCTTTGGACGAAAGTGCTATCGTGGTTAAAATCCAAGGTTAT
                    ****************** *****************************************

HsCD00512497        TTTGATGCATGGCAAGCTCTCCTCATCAAACCAGACATCTTCTTTAAGATTTCTTGGCTA
NM_031226.2         TTTGATGCATGGCAAGCTCTCCTCATCAAACCAGACATCTTCTTTAAGATTTCTTGGCTA
XM_005254190.1      TTTGATGCATGGCAAGCTCTCCTCATCAAACCAGACATCTTCTTTAAGATTTCTTGGCTA
XM_005254191.1      TTTGATGCATGGCAAGCTCTCCTCATCAAACCAGACATCTTCTTTAAGATTTCTTGGCTA
NM_000103.3         TTTGATGCATGGCAAGCTCTCCTCATCAAACCAGACATCTTCTTTAAGATTTCTTGGCTA
                    ************************************************************

HsCD00512497        TACAAAAAGTATGAGAAGTCTGTCAAGGATTTGAAAGATGCCATAGAAGTTCTGATAGCA
NM_031226.2         TACAAAAAGTATGAGAAGTCTGTCAAGGATTTGAAAGATGCCATAGAAGTTCTGATAGCA
XM_005254190.1      TACAAAAAGTATGAGAAGTCTGTCAAGGATTTGAAAGATGCCATAGAAGTTCTGATAGCA
XM_005254191.1      TACAAAAAGTATGAGAAGTCTGTCAAGGATTTGAAAGATGCCATAGAAGTTCTGATAGCA
NM_000103.3         TACAAAAAGTATGAGAAGTCTGTCAAGGATTTGAAAGATGCCATAGAAGTTCTGATAGCA
                    ************************************************************

HsCD00512497        GAAAAAAGACGCAGGATTTCCACAGAAGAGAAACTGGAAGAATGTATGGACTTTGCCACT
NM_031226.2         GAAAAAAGACGCAGGATTTCCACAGAAGAGAAACTGGAAGAATGTATGGACTTTGCCACT
XM_005254190.1      GAAAAAAGACGCAGGATTTCCACAGAAGAGAAACTGGAAGAATGTATGGACTTTGCCACT
XM_005254191.1      GAAAAAAGACGCAGGATTTCCACAGAAGAGAAACTGGAAGAATGTATGGACTTTGCCACT
NM_000103.3         GAAAAAAGACGCAGGATTTCCACAGAAGAGAAACTGGAAGAATGTATGGACTTTGCCACT
                    ************************************************************

HsCD00512497        GAGTTGATTTTAGCAGAGAAACGTGGTGACCTGACAAGAGAGAATGTGAACCAGTGCATA
NM_031226.2         GAGTTGATTTTAGCAGAGAAACGTGGTGACCTGACAAGAGAGAATGTGAACCAGTGCATA
XM_005254190.1      GAGTTGATTTTAGCAGAGAAACGTGGTGACCTGACAAGAGAGAATGTGAACCAGTGCATA
XM_005254191.1      GAGTTGATTTTAGCAGAGAAACGTGGTGACCTGACAAGAGAGAATGTGAACCAGTGCATA
NM_000103.3         GAGTTGATTTTAGCAGAGAAACGTGGTGACCTGACAAGAGAGAATGTGAACCAGTGCATA
                    ************************************************************

HsCD00512497        TTGGAAATGCTGATCGCAGCTCCTGACACCATGTCTGTCTCTTTGTTCTTCATGCTATTT
NM_031226.2         TTGGAAATGCTGATCGCAGCTCCTGACACCATGTCTGTCTCTTTGTTCTTCATGCTATTT
XM_005254190.1      TTGGAAATGCTGATCGCAGCTCCTGACACCATGTCTGTCTCTTTGTTCTTCATGCTATTT
XM_005254191.1      TTGGAAATGCTGATCGCAGCTCCTGACACCATGTCTGTCTCTTTGTTCTTCATGCTATTT
NM_000103.3         TTGGAAATGCTGATCGCAGCTCCTGACACCATGTCTGTCTCTTTGTTCTTCATGCTATTT
                    ************************************************************

HsCD00512497        CTCATTGCAAAGCACCCTAATGTTGAAGAGGCAATAATAAAGGAAATCCAGACTGTTATT
NM_031226.2         CTCATTGCAAAGCACCCTAATGTTGAAGAGGCAATAATAAAGGAAATCCAGACTGTTATT
XM_005254190.1      CTCATTGCAAAGCACCCTAATGTTGAAGAGGCAATAATAAAGGAAATCCAGACTGTTATT
XM_005254191.1      CTCATTGCAAAGCACCCTAATGTTGAAGAGGCAATAATAAAGGAAATCCAGACTGTTATT
NM_000103.3         CTCATTGCAAAGCACCCTAATGTTGAAGAGGCAATAATAAAGGAAATCCAGACTGTTATT
                    ************************************************************

HsCD00512497        GGTGAGAGAGACATAAAGATTGATGATATACAAAAATTAAAAGTGATGGAAAACTTCATT
NM_031226.2         GGTGAGAGAGACATAAAGATTGATGATATACAAAAATTAAAAGTGATGGAAAACTTCATT
XM_005254190.1      GGTGAGAGAGACATAAAGATTGATGATATACAAAAATTAAAAGTGATGGAAAACTTCATT
XM_005254191.1      GGTGAGAGAGACATAAAGATTGATGATATACAAAAATTAAAAGTGATGGAAAACTTCATT
NM_000103.3         GGTGAGAGAGACATAAAGATTGATGATATACAAAAATTAAAAGTGATGGAAAACTTCATT
                    ************************************************************

HsCD00512497        TATGAGAGCATGCGGTACCAGCCTGTCGTGGACTTGGTCATGCGCAAAGCCTTAGAAGAT
NM_031226.2         TATGAGAGCATGCGGTACCAGCCTGTCGTGGACTTGGTCATGCGCAAAGCCTTAGAAGAT
XM_005254190.1      TATGAGAGCATGCGGTACCAGCCTGTCGTGGACTTGGTCATGCGCAAAGCCTTAGAAGAT
XM_005254191.1      TATGAGAGCATGCGGTACCAGCCTGTCGTGGACTTGGTCATGCGCAAAGCCTTAGAAGAT
NM_000103.3         TATGAGAGCATGCGGTACCAGCCTGTCGTGGACTTGGTCATGCGCAAAGCCTTAGAAGAT
                    ************************************************************

HsCD00512497        GATGTAATCGATGGCTACCCAGTGAAAAAGGGGACAAACATTATCCTGAATATTGGAAGG
NM_031226.2         GATGTAATCGATGGCTACCCAGTGAAAAAGGGGACAAACATTATCCTGAATATTGGAAGG
XM_005254190.1      GATGTAATCGATGGCTACCCAGTGAAAAAGGGGACAAACATTATCCTGAATATTGGAAGG
XM_005254191.1      GATGTAATCGATGGCTACCCAGTGAAAAAGGGGACAAACATTATCCTGAATATTGGAAGG
NM_000103.3         GATGTAATCGATGGCTACCCAGTGAAAAAGGGGACAAACATTATCCTGAATATTGGAAGG
                    ************************************************************

HsCD00512497        ATGCACAGACTCGAGTTTTTCCCCAAACCCAATGAATTTACTCTTGAAAATTTTGCAAAG
NM_031226.2         ATGCACAGACTCGAGTTTTTCCCCAAACCCAATGAATTTACTCTTGAAAATTTTGCAAAG
XM_005254190.1      ATGCACAGACTCGAGTTTTTCCCCAAACCCAATGAATTTACTCTTGAAAATTTTGCAAAG
XM_005254191.1      ATGCACAGACTCGAGTTTTTCCCCAAACCCAATGAATTTACTCTTGAAAATTTTGCAAAG
NM_000103.3         ATGCACAGACTCGAGTTTTTCCCCAAACCCAATGAATTTACTCTTGAAAATTTTGCAAAG
                    ************************************************************

HsCD00512497        AATGTTCCTTATAGGTACTTTCAGCCATTTGGCTTTGGGCCCCGTGGCTGTGCAGGAAAG
NM_031226.2         AATGTTCCTTATAGGTACTTTCAGCCATTTGGCTTTGGGCCCCGTGGCTGTGCAGGAAAG
XM_005254190.1      AATGTTCCTTATAGGTACTTTCAGCCATTTGGCTTTGGGCCCCGTGGCTGTGCAGGAAAG
XM_005254191.1      AATGTTCCTTATAGGTACTTTCAGCCATTTGGCTTTGGGCCCCGTGGCTGTGCAGGAAAG
NM_000103.3         AATGTTCCTTATAGGTACTTTCAGCCATTTGGCTTTGGGCCCCGTGGCTGTGCAGGAAAG
                    ************************************************************

HsCD00512497        TACATCGCCATGGTGATGATGAAAGCCATCCTCGTTACACTTCTGAGACGATTCCACGTG
NM_031226.2         TACATCGCCATGGTGATGATGAAAGCCATCCTCGTTACACTTCTGAGACGATTCCACGTG
XM_005254190.1      TACATCGCCATGGTGATGATGAAAGCCATCCTCGTTACACTTCTGAGACGATTCCACGTG
XM_005254191.1      TACATCGCCATGGTGATGATGAAAGCCATCCTCGTTACACTTCTGAGACGATTCCACGTG
NM_000103.3         TACATCGCCATGGTGATGATGAAAGCCATCCTCGTTACACTTCTGAGACGATTCCACGTG
                    ************************************************************

HsCD00512497        AAGACATTGCAAGGACAGTGTGTTGAGAGCATACAGAAGATACACGACTTGTCCTTGCAC
NM_031226.2         AAGACATTGCAAGGACAGTGTGTTGAGAGCATACAGAAGATACACGACTTGTCCTTGCAC
XM_005254190.1      AAGACATTGCAAGGACAGTGTGTTGAGAGCATACAGAAGATACACGACTTGTCCTTGCAC
XM_005254191.1      AAGACATTGCAAGGACAGTGTGTTGAGAGCATACAGAAGATACACGACTTGTCCTTGCAC
NM_000103.3         AAGACATTGCAAGGACAGTGTGTTGAGAGCATACAGAAGATACACGACTTGTCCTTGCAC
                    ************************************************************

HsCD00512497        CCAGATGAGACTAAAAACATGCTGGAAATGATCTTTACCCCAAGAAACTCAGACAGGTGT
NM_031226.2         CCAGATGAGACTAAAAACATGCTGGAAATGATCTTTACCCCAAGAAACTCAGACAGGTGT
XM_005254190.1      CCAGATGAGACTAAAAACATGCTGGAAATGATCTTTACCCCAAGAAACTCAGACAGGTGT
XM_005254191.1      CCAGATGAGACTAAAAACATGCTGGAAATGATCTTTACCCCAAGAAACTCAGACAGGTGT
NM_000103.3         CCAGATGAGACTAAAAACATGCTGGAAATGATCTTTACCCCAAGAAACTCAGACAGGTGT
                    ************************************************************

HsCD00512497        CTGGAACAC---
NM_031226.2         CTGGAACACTAG
XM_005254190.1      CTGGAACACTAG
XM_005254191.1      CTGGAACACTAG
NM_000103.3         CTGGAACACTAG
                    *********   

Pathways

Panther : Androgen/estrogene/progesterone biosynthesis
Reactome : Biological oxidations
Reactome : Cytochrome P450 - arranged by substrate type
Reactome : Endogenous sterols
Reactome : Estrogen biosynthesis
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Metabolism of steroid hormones and vitamin D
Reactome : Phase 1 - Functionalization of compounds
Reactome : Steroid hormones
WikiPathway : FSH signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Ovarian Infertility Genes
WikiPathway : Tryptophan metabolism
WikiPathway : cytochrome P450
WikiPathway : metapathway biotransformation

Protein

HPRD : 00488

Clone

Cloning Information : 604394
Original Clone ID : ccsbBroadEn_06078

Organism


TAX_ID : 9606
Species Specific ID: 1588

Genome

Chromosome : 15
Map Location : 15q21.1
Ensembl : ENSG00000137869

Reagents

Labome : aromatase-antibody