DNASU Plasmid Repository • 480.965.5697 | Email

POLR2H (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  POLR2H
Gene Name:  polymerase (RNA) II (DNA directed) polypeptide H
Sequence             
Original Clone ID: ccsbBroadEn_06750
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC000739.2
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00512612

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 451nts         Open reading frame : 1 to 451
Reference Sequence Alignment

ATGGCGGGCATCCTGTTTGAGGATATTTTCGATGTGAAGGATATTGACCCGGAGGGCAAG
AAGTTTGACCGAGTGTCTCGACTGCATTGTGAGAGTGAATCTTTCAAGATGGATCTAATC
TTAGATGTAAACATTCAAATTTACCCTGTAGACTTGGGTGACAAGTTTCGGTTGGTCATA
GCTAGTACCTTGTATGAAGATGGTACCCTGGATGATGGTGAATACAACCCCACTGATGAT
AGGCCTTCCAGGGCTGACCAGTTTGAGTATGTAATGTATGGAAAAGTGTACAGGATTGAG
GGAGATGAAACTTCTACTGAAGCAGCAACACGCCTCTCTGCGTACGTGTCCTATGGGGGC
CTGCTCATGAGGCTGCAGGGGGATGCCAACAACCTGCATGGATTCGAGGTGGACTCCAGA
GTTTATCTCCTGATGAAGAAGCTAGCCTTC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : POLR2H
Symbol Nomenclature : POLR2H
SYNONYM : RPABC3; RPB17; RPB8
Designation : DNA-directed RNA polymerase II subunit H|DNA-directed RNA polymerases I, II, and III 17.1 kDa polypeptide|DNA-directed RNA polymerases I, II, and III subunit RPABC3|RPB8 homolog
Full Nomenclature : polymerase (RNA) II (DNA directed) polypeptide H
GENEID : 5437
GenBank Accession : EU446997
HGNC : 9195
MIM : 606023
Vega : OTTHUMG00000156746
Target GenBank: EU446997

 

Reference Sequence Alignment

  

HsCD00512612        ATGGCGGGCATCCTGTTTGAGGATATTTTCGATGTGAAGGATATTGACCCGGAGGGCAAG
NM_006232.3         ATGGCGGGCATCCTGTTTGAGGATATTTTCGATGTGAAGGATATTGACCCGGAGGGCAAG
XM_005247541.1      ATGGCGGGCATCCTGTTTGAGGATATTTTCGATGTGAAGGATATTGACCCGGAGGGCAAG
NM_001278698.1      ATGGCGGGCATCCTGTTTGAGGATATTTTCGATGTGAAGGATATTGACCCGGAGGGCAAG
                    ************************************************************

HsCD00512612        AAGTTTGACCGAGTGTCTCGACTGCATTGTGAGAGTGAATCTTTCAAGATGGATCTAATC
NM_006232.3         AAGTTTGACCGAGTGTCTCGACTGCATTGTGAGAGTGAATCTTTCAAGATGGATCTAATC
XM_005247541.1      AAGTTTGACCGAGTGTCTCGACTGCATTGTGAGAGTGAATCTTTCAAGATGGATCTAATC
NM_001278698.1      AAGTTTGACCGAGTGTCTCGACTGCATTGTGAGAGTGAATCTTTCAAGATGGATCTAATC
                    ************************************************************

HsCD00512612        TTAGATGTAAACATTCAAATTTACCCTGTAGACTTGGGTGACAAGTTTCGGTTGGTCATA
NM_006232.3         TTAGATGTAAACATTCAAATTTACCCTGTAGACTTGGGTGACAAGTTTCGGTTGGTCATA
XM_005247541.1      TTAGATGTAAACATTCAAATTTACCCTGTAGACTTGGGTGACAAGTTTCGGTTGGTCATA
NM_001278698.1      TTAGATGTAAACATTCAAATTTACCCTGTAGACTTGGGTGACAAGTTTCGGTTGGTCATA
                    ************************************************************

HsCD00512612        GCTAGTACCTTGTATGAAGATGGTACCCTGGATGATGGTGAATACAACCCCACTGATGAT
NM_006232.3         GCTAGTACCTTGTATGAAGATGGTACCCTGGATGATGGTGAATACAACCCCACTGATGAT
XM_005247541.1      GCTAGTACCTTGTATGAAGATGGTACCCTGGATGATGGTGAATACAACCCCACTGATGAT
NM_001278698.1      GCTAGTACCTTGTATGAAGATGGTACCCTGGATGATGGTGAATACAACCCCACTGATGAT
                    ************************************************************

HsCD00512612        AGGCCTTCCAGGGCTGACCAGTTTGAGTATGTAATGTATGGAAAAGTGTACAGGATTGAG
NM_006232.3         AGGCCTTCCAGGGCTGACCAGTTTGAGTATGTAATGTATGGAAAAGTGTACAGGATTGAG
XM_005247541.1      AGGCCTTCCAGGGCTGACCAGTTTGAGTATGTAATGTATGGAAAAGTGTACAGGATTGAG
NM_001278698.1      AGGCCTTCCAGGGCTGACCAGTTTGAGTATGTAATGTATGGAAAAGTGTACAGGATTGAG
                    ************************************************************

HsCD00512612        GGAGATGAAACTTCTACTGAAGCAGCAACACGCCT-------------------------
NM_006232.3         GGAGATGAAACTTCTACTGAAGCAGCAACACGCCT-------------------------
XM_005247541.1      GGAGATGAAACTTCTACTGAAGCAGCAACACGCCTGCTGAGATTGAGAGCTGCTGAGTGG
NM_001278698.1      GGAGATGAAACTTCTACTGAAGCAGCAACACGCCTGCTGAGATTGAGAGCTGCTGAGTGG
                    ***********************************                         

HsCD00512612        ---------------------------------------CTCTGCGTACGTGTCCTATGG
NM_006232.3         ---------------------------------------CTCTGCGTACGTGTCCTATGG
XM_005247541.1      CAGTGCTCCAGAATCACGGGATGGGGCCTTCTGTTTCAGCTCTGCGTACGTGTCCTATGG
NM_001278698.1      CAGTGCTCCAGAATCACGGGATGGGGCCTTCTGTTTCAGCTCTGCGTACGTGTCCTATGG
                                                           *********************

HsCD00512612        GGGCCTGCTCATGAGGCTGCAGGGGGATGCCAACAACCTGCATGGATTCGAGGTGGACTC
NM_006232.3         GGGCCTGCTCATGAGGCTGCAGGGGGATGCCAACAACCTGCATGGATTCGAGGTGGACTC
XM_005247541.1      GGGCCTGCTCATGAGGCTGCAGGGGGATGCCAACAACCTGCATGGATTCGAGGTGGACTC
NM_001278698.1      GGGCCTGCTCATGAGGCTGCAGGGGGATGCCAACAACCTGCATGGATTCGAGGTGGACTC
                    ************************************************************

HsCD00512612        CAGAGTTTATCTCCTGATGAAGAAGCTAGCCTTC--------------
NM_006232.3         CAGAGTTTATCTCCTGATGAAGAAGCTAGCCTTCTGA-----------
XM_005247541.1      CAGAGTTTATCTCCTGATGAAGAAGCTAGCCTTCTGAACCTCGCCTGA
NM_001278698.1      CAGAGTTTATCTCCTGATGAAGAAGCTAGCCTTCTGAACCTCGCCTGA
                    **********************************              

Pathways

Panther : General transcription regulation
Panther : Transcription regulation by bZIP transcription factor
Reactome : Abortive elongation of HIV-1 transcript in the absence of Tat
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DNA Repair
Reactome : Disease
Reactome : Dual incision reaction in TC-NER
Reactome : Elongation arrest and recovery
Reactome : Epigenetic regulation of gene expression
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Formation of the Early Elongation Complex
Reactome : Formation of the HIV-1 Early Elongation Complex
Reactome : Formation of transcription-coupled NER (TC-NER) repair complex
Reactome : Gene Expression
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : HIV Transcription Initiation
Reactome : HIV elongation arrest and recovery
Reactome : Immune System
Reactome : Influenza Infection
Reactome : Influenza Life Cycle
Reactome : Influenza Viral RNA Transcription and Replication
Reactome : Innate Immune System
Reactome : Late Phase of HIV Life Cycle
Reactome : MicroRNA (miRNA) biogenesis
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : Nucleotide Excision Repair
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : Processing of Capped Intron-Containing Pre-mRNA
Reactome : RNA Pol II CTD phosphorylation and interaction with CE
Reactome : RNA Polymerase I Chain Elongation
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Promoter Escape
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I Transcription Initiation
Reactome : RNA Polymerase I Transcription Termination
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : RNA Polymerase II HIV Promoter Escape
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Promoter Escape
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : RNA Polymerase II Transcription Initiation
Reactome : RNA Polymerase II Transcription Initiation And Promoter Clearance
Reactome : RNA Polymerase II Transcription Pre-Initiation And Promoter Opening
Reactome : RNA Polymerase III Abortive And Retractive Initiation
Reactome : RNA Polymerase III Chain Elongation
Reactome : RNA Polymerase III Transcription
Reactome : RNA Polymerase III Transcription Initiation
Reactome : RNA Polymerase III Transcription Initiation From Type 1 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 2 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 3 Promoter
Reactome : RNA Polymerase III Transcription Termination
Reactome : Regulatory RNA pathways
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcription-coupled NER (TC-NER)
Reactome : Viral Messenger RNA Synthesis
Reactome : mRNA Capping
Reactome : mRNA Splicing
Reactome : mRNA Splicing - Major Pathway
Reactome : mRNA Splicing - Minor Pathway
WikiPathway : Eukaryotic Transcription Initiation

Protein

SMART domain : RPOL8c : RNA polymerase subunit 8
HPRD : 09082

Clone

Cloning Information : 607284
Original Clone ID : ccsbBroadEn_06750

Organism


TAX_ID : 9606
Species Specific ID: 5437

Genome

Chromosome : 3
Map Location : 3q28
Ensembl : ENSG00000163882

Reagents

Labome : POLR2H-antibody