DNASU Plasmid Repository • 480.965.5697 | Email

ATM (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ATM
Gene Name:  ataxia telangiectasia mutated
Sequence             
Original Clone ID: ccsbBroadEn_10689
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC022307.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00513726

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 394nts         Open reading frame : 1 to 394
Reference Sequence Alignment

ATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGTCAGAGCACTGACCTCTGTGACTTT
TCAGGGGATTTGGATCCTGCTCCTAATCCACCTCATTTTCCATCGCATGTGATTAAAGCA
ACATTTGCCTATATCAGCAATTGTCATAAAACCAAGTTAAAAAGCATTTTAGAAATTCTT
TCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTTGCCATATGTGAGCAAGCAGCTGAA
ACAAATAATGTTTATAAGAAGCACAGAATTCTTAAAATATATCACCTGTTTGTTAGTTTA
TTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCTTGGGCCTTTGTTCTTCGAGACGTT
ATTTATACTTTGATTCACTATATCAACCAAAGG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ATM
Symbol Nomenclature : ATM
SYNONYM : AT1; ATA; ATC; ATD; ATDC; ATE; TEL1; TELO1
Designation : A-T mutated|AT mutated|TEL1, telomere maintenance 1, homolog|serine-protein kinase ATM
Full Nomenclature : ataxia telangiectasia mutated
GENEID : 472
HGNC : 795
MIM : 607585
Vega : OTTHUMG00000166480
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ATGAGTCTAGTACTTAATGATCTGCTTATCTGCTGCCGTCAACTAGAACATGATAGAGCT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ACAGAACGAAAGAAAGAAGTTGAGAAATTTAAGCGCCTGATTCGAGATCCTGAAACAATT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AAACATCTAGATCGGCATTCAGATTCCAAACAAGGAAAATATTTGAATTGGGATGCTGTT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TTTAGATTTTTACAGAAATATATTCAGAAAGAAACAGAATGTCTGAGAATAGCAAAACCA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AATGTATCAGCCTCAACACAAGCCTCCAGGCAGAAAAAGATGCAGGAAATCAGTAGTTTG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GTCAAATACTTCATCAAATGTGCAAACAGAAGAGCACCTAGGCTAAAATGTCAAGAACTC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TTAAATTATATCATGGATACAGTGAAAGATTCATCTAATGGTGCTATTTACGGAGCTGAT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TGTAGCAACATACTACTCAAAGACATTCTTTCTGTGAGAAAATACTGGTGTGAAATATCT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CAGCAACAGTGGTTAGAATTGTTCTCTGTGTACTTCAGGCTCTATCTGAAACCTTCACAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GATGTTCATAGAGTTTTAGTGGCTAGAATAATTCATGCTGTTACCAAAGGATGCTGTTCT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CAGACTGACGGATTAAATTCCAAATTTTTGGACTTTTTTTCCAAGGCTATTCAGTGTGCG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AGACAAGAAAAGAGCTCTTCAGGTCTAAATCATATCTTAGCAGCTCTTACTATCTTCCTC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AAGACTTTGGCTGTCAACTTTCGAATTCGAGTGTGTGAATTAGGAGATGAAATTCTTCCC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ACTTTGCTTTATATTTGGACTCAACATAGGCTTAATGATTCTTTAAAAGAAGTCATTATT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GAATTATTTCAACTGCAAATTTATATCCATCATCCGAAAGGAGCCAAAACCCAAGAAAAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GGTGCTTATGAATCAACAAAATGGAGAAGTATTTTATACAACTTATATGATCTGCTAGTG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AATGAGATAAGTCATATAGGAAGTAGAGGAAAGTATTCTTCAGGATTTCGTAATATTGCC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GTCAAAGAAAATTTGATTGAATTGATGGCAGATATCTGTCACCAGGTTTTTAATGAAGAT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ACCAGATCCTTGGAGATTTCTCAATCTTACACTACTACACAAAGAGAATCTAGTGATTAC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AGTGTCCCTTGCAAAAGGAAGAAAATAGAACTAGGCTGGGAAGTAATAAAAGATCACCTT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CAGAAGTCACAGAATGATTTTGATCTTGTGCCTTGGCTACAGATTGCAACCCAATTAATA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TCAAAGTATCCTGCAAGTTTACCTAACTGTGAGCTGTCTCCATTACTGATGATACTATCT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CAGCTTCTACCCCAACAGCGACATGGGGAACGTACACCATATGTGTTACGATGCCTTACG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GAAGTTGCATTGTGTCAAGACAAGAGGTCAAACCTAGAAAGCTCACAAAAGTCAGATTTA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TTAAAACTCTGGAATAAAATTTGGTGTATTACCTTTCGTGGTATAAGTTCTGAGCAAATA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CAAGCTGAAAACTTTGGCTTACTTGGAGCCATAATTCAGGGTAGTTTAGTTGAGGTTGAC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AGAGAATTCTGGAAGTTATTTACTGGGTCAGCCTGCAGACCTTCATGTCCTGCAGTATGC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TGTTTGACTTTGGCACTGACCACCAGTATAGTTCCAGGAACGGTAAAAATGGGAATAGAG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CAAAATATGTGTGAAGTAAATAGAAGCTTTTCTTTAAAGGAATCAATAATGAAATGGCTC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TTATTCTATCAGTTAGAGGGTGACTTAGAAAATAGCACAGAAGTGCCTCCAATTCTTCAC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AGTAATTTTCCTCATCTTGTACTGGAGAAAATTCTTGTGAGTCTCACTATGAAAAACTGT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AAAGCTGCAATGAATTTTTTCCAAAGCGTGCCAGAATGTGAACACCACCAAAAAGATAAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GAAGAACTTTCATTCTCAGAAGTAGAAGAACTATTTCTTCAGACAACTTTTGACAAGATG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GACTTTTTAACCATTGTGAGAGAATGTGGTATAGAAAAGCACCAGTCCAGTATTGGCTTC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TCTGTCCACCAGAATCTCAAGGAATCACTGGATCGCTGTCTTCTGGGATTATCAGAACAG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CTTCTGAATAATTACTCATCTGAGATTACAAATTCAGAAACTCTTGTCCGGTGTTCACGT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CTTTTGGTGGGTGTCCTTGGCTGCTACTGTTACATGGGTGTAATAGCTGAAGAGGAAGCA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TATAAGTCAGAATTATTCCAGAAAGCCAAGTCTCTAATGCAATGTGCAGGAGAAAGTATC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ACTCTGTTTAAAAATAAGACAAATGAGGAATTCAGAATTGGTTCCTTGAGAAATATGATG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CAGCTATGTACACGTTGCTTGAGCAACTGTACCAAGAAGAGTCCAAATAAGATTGCATCT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GGCTTTTTCCTGCGATTGTTAACATCAAAGCTAATGAATGACATTGCAGATATTTGTAAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AGTTTAGCATCCTTCATCAAAAAGCCATTTGACCGTGGAGAAGTAGAATCAATGGAAGAT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GATACTAATGGAAATCTAATGGAGGTGGAGGATCAGTCATCCATGAATCTATTTAACGAT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TACCCTGATAGTAGTGTTAGTGATGCAAACGAACCTGGAGAGAGCCAAAGTACCATAGGT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GCCATTAATCCTTTAGCTGAAGAATATCTGTCAAAGCAAGATCTACTTTTCTTAGACATG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CTCAAGTTCTTGTGTTTGTGTGTAACTACTGCTCAGACCAATACTGTGTCCTTTAGGGCA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GCTGATATTCGGAGGAAATTGTTAATGTTAATTGATTCTAGCACGCTAGAACCTACCAAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TCCCTCCACCTGCATATGTATCTAATGCTTTTAAAGGAGCTTCCTGGAGAAGAGTACCCC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TTGCCAATGGAAGATGTTCTTGAACTTCTGAAACCACTATCCAATGTGTGTTCTTTGTAT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CGTCGTGACCAAGATGTTTGTAAAACTATTTTAAACCATGTCCTTCATGTAGTGAAAAAC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CTAGGTCAAAGCAATATGGACTCTGAGAACACAAGGGATGCTCAAGGACAGTTTCTTACA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GTAATTGGAGCATTTTGGCATCTAACAAAGGAGAGGAAATATATATTCTCTGTAAGAATG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GCCCTAGTAAATTGCCTTAAAACTTTGCTTGAGGCTGATCCTTATTCAAAATGGGCCATT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CTTAATGTAATGGGAAAAGACTTTCCTGTAAATGAAGTATTTACACAATTTCTTGCTGAC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AATCATCACCAAGTTCGCATGTTGGCTGCAGAGTCAATCAATAGATTGTTCCAGGACACG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AAGGGAGATTCTTCCAGGTTACTGAAAGCACTTCCTTTGAAGCTTCAGCAAACAGCTTTT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GAAAATGCATACTTGAAAGCTCAGGAAGGAATGAGAGAAATGTCCCATAGTGCTGAGAAC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CCTGAAACTTTGGATGAAATTTATAATAGAAAATCTGTTTTACTGACGTTGATAGCTGTG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GTTTTATCCTGTAGCCCTATCTGCGAAAAACAGGCTTTGTTTGCCCTGTGTAAATCTGTG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AAAGAGAATGGATTAGAACCTCACCTTGTGAAAAAGGTTTTAGAGAAAGTTTCTGAAACT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TTTGGATATAGACGTTTAGAAGACTTTATGGCATCTCATTTAGATTATCTGGTTTTGGAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TGGCTAAATCTTCAAGATACTGAATACAACTTATCTTCTTTTCCTTTTATTTTATTAAAC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TACACAAATATTGAGGATTTCTATAGATCTTGTTATAAGGTTTTGATTCCACATCTGGTG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ATTAGAAGTCATTTTGATGAGGTGAAGTCCATTGCTAATCAGATTCAAGAGGACTGGAAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AGTCTTCTAACAGACTGCTTTCCAAAGATTCTTGTAAATATTCTTCCTTATTTTGCCTAT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GAGGGTACCAGAGACAGTGGGATGGCACAGCAAAGAGAGACTGCTACCAAGGTCTATGAT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ATGCTTAAAAGTGAAAACTTATTGGGAAAACAGATTGATCACTTATTCATTAGTAATTTA
                                                                              

HsCD00513726      ------------------------ATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGT
NM_000051.3       CCAGAGATTGTGGTGGAGTTATTGATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGT
                                          ************************************

HsCD00513726      CAGAGCACTGACCTCTGTGACTTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCAT
NM_000051.3       CAGAGCACTGACCTCTGTGACTTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCAT
                  ************************************************************

HsCD00513726      TTTCCATCGCATGTGATTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAG
NM_000051.3       TTTCCATCGCATGTGATTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAG
                  ************************************************************

HsCD00513726      TTAAAAAGCATTTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTT
NM_000051.3       TTAAAAAGCATTTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTT
                  ************************************************************

HsCD00513726      GCCATATGTGAGCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTAAA
NM_000051.3       GCCATATGTGAGCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTAAA
                  ************************************************************

HsCD00513726      ATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCT
NM_000051.3       ATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCT
                  ************************************************************

HsCD00513726      TGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATTCACTATATCAACCAAAGG---
NM_000051.3       TGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATTCACTATATCAACCAAAGGCCT
                  *********************************************************   

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TCTTGTATCATGGATGTGTCATTACGTAGCTTCTCCCTTTGTTGTGACTTATTAAGTCAG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GTTTGCCAGACAGCCGTGACTTACTGTAAGGATGCTCTAGAAAACCATCTTCATGTTATT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GTTGGTACACTTATACCCCTTGTGTATGAGCAGGTGGAGGTTCAGAAACAGGTATTGGAC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TTGTTGAAATACTTAGTGATAGATAACAAGGATAATGAAAACCTCTATATCACGATTAAG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CTTTTAGATCCTTTTCCTGACCATGTTGTTTTTAAGGATTTGCGTATTACTCAGCAAAAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ATCAAATACAGTAGAGGACCCTTTTCACTCTTGGAGGAAATTAACCATTTTCTCTCAGTA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AGTGTTTATGATGCACTTCCATTGACAAGACTTGAAGGACTAAAGGATCTTCGAAGACAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CTGGAACTACATAAAGATCAGATGGTGGACATTATGAGAGCTTCTCAGGATAATCCGCAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GATGGGATTATGGTGAAACTAGTTGTCAATTTGTTGCAGTTATCCAAGATGGCAATAAAC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CACACTGGTGAAAAAGAAGTTCTAGAGGCTGTTGGAAGCTGCTTGGGAGAAGTGGGTCCT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ATAGATTTCTCTACCATAGCTATACAACATAGTAAAGATGCATCTTATACCAAGGCCCTT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AAGTTATTTGAAGATAAAGAACTTCAGTGGACCTTCATAATGCTGACCTACCTGAATAAC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ACACTGGTAGAAGATTGTGTCAAAGTTCGATCAGCAGCTGTTACCTGTTTGAAAAACATT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TTAGCCACAAAGACTGGACATAGTTTCTGGGAGATTTATAAGATGACAACAGATCCAATG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CTGGCCTATCTACAGCCTTTTAGAACATCAAGAAAAAAGTTTTTAGAAGTACCCAGATTT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GACAAAGAAAACCCTTTTGAAGGCCTGGATGATATAAATCTGTGGATTCCTCTAAGTGAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AATCATGACATTTGGATAAAGACACTGACTTGTGCTTTTTTGGACAGTGGAGGCACAAAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TGTGAAATTCTTCAATTATTAAAGCCAATGTGTGAAGTGAAAACTGACTTTTGTCAGACT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GTACTTCCATACTTGATTCATGATATTTTACTCCAAGATACAAATGAATCATGGAGAAAT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CTGCTTTCTACACATGTTCAGGGATTTTTCACCAGCTGTCTTCGACACTTCTCGCAAACG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AGCCGATCCACAACCCCTGCAAACTTGGATTCAGAGTCAGAGCACTTTTTCCGATGCTGT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TTGGATAAAAAATCACAAAGAACAATGCTTGCTGTTGTGGACTACATGAGAAGACAAAAG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AGACCTTCTTCAGGAACAATTTTTAATGATGCTTTCTGGCTGGATTTAAATTATCTAGAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GTTGCCAAGGTAGCTCAGTCTTGTGCTGCTCACTTTACAGCTTTACTCTATGCAGAAATC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TATGCAGATAAGAAAAGTATGGATGATCAAGAGAAAAGAAGTCTTGCATTTGAAGAAGGA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AGCCAGAGTACAACTATTTCTAGCTTGAGTGAAAAAAGTAAAGAAGAAACTGGAATAAGT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TTACAGGATCTTCTCTTAGAAATCTACAGAAGTATAGGGGAGCCAGATAGTTTGTATGGC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TGTGGTGGAGGGAAGATGTTACAACCCATTACTAGACTACGAACATATGAACACGAAGCA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ATGTGGGGCAAAGCCCTAGTAACATATGACCTCGAAACAGCAATCCCCTCATCAACACGC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CAGGCAGGAATCATTCAGGCCTTGCAGAATTTGGGACTCTGCCATATTCTTTCCGTCTAT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TTAAAAGGATTGGATTATGAAAATAAAGACTGGTGTCCTGAACTAGAAGAACTTCATTAC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CAAGCAGCATGGAGGAATATGCAGTGGGACCATTGCACTTCCGTCAGCAAAGAAGTAGAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GGAACCAGTTACCATGAATCATTGTACAATGCTCTACAATCTCTAAGAGACAGAGAATTC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TCTACATTTTATGAAAGTCTCAAATATGCCAGAGTAAAAGAAGTGGAAGAGATGTGTAAG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CGCAGCCTTGAGTCTGTGTATTCGCTCTATCCCACACTTAGCAGGTTGCAGGCCATTGGA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GAGCTGGAAAGCATTGGGGAGCTTTTCTCAAGATCAGTCACACATAGACAACTCTCTGAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GTATATATTAAGTGGCAGAAACACTCCCAGCTTCTCAAGGACAGTGATTTTAGTTTTCAG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GAGCCTATCATGGCTCTACGCACAGTCATTTTGGAGATCCTGATGGAAAAGGAAATGGAC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AACTCACAAAGAGAATGTATTAAGGACATTCTCACCAAACACCTTGTAGAACTCTCTATA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CTGGCCAGAACTTTCAAGAACACTCAGCTCCCTGAAAGGGCAATATTTCAAATTAAACAG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TACAATTCAGTTAGCTGTGGAGTCTCTGAGTGGCAGCTGGAAGAAGCACAAGTATTCTGG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GCAAAAAAGGAGCAGAGTCTTGCCCTGAGTATTCTCAAGCAAATGATCAAGAAGTTGGAT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GCCAGCTGTGCAGCGAACAATCCCAGCCTAAAACTTACATACACAGAATGTCTGAGGGTT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TGTGGCAACTGGTTAGCAGAAACGTGCTTAGAAAATCCTGCGGTCATCATGCAGACCTAT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CTAGAAAAGGCAGTAGAAGTTGCTGGAAATTATGATGGAGAAAGTAGTGATGAGCTAAGA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AATGGAAAAATGAAGGCATTTCTCTCATTAGCCCGGTTTTCAGATACTCAATACCAAAGA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ATTGAAAACTACATGAAATCATCGGAATTTGAAAACAAGCAAGCTCTCCTGAAAAGAGCC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AAAGAGGAAGTAGGTCTCCTTAGGGAACATAAAATTCAGACAAACAGATACACAGTAAAG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GTTCAGCGAGAGCTGGAGTTGGATGAATTAGCCCTGCGTGCACTGAAAGAGGATCGTAAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CGCTTCTTATGTAAAGCAGTTGAAAATTATATCAACTGCTTATTAAGTGGAGAAGAACAT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GATATGTGGGTATTCCGACTTTGTTCCCTCTGGCTTGAAAATTCTGGAGTTTCTGAAGTC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AATGGCATGATGAAGAGAGACGGAATGAAGATTCCAACATATAAATTTTTGCCTCTTATG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TACCAATTGGCTGCTAGAATGGGGACCAAGATGATGGGAGGCCTAGGATTTCATGAAGTC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CTCAATAATCTAATCTCTAGAATTTCAATGGATCACCCCCATCACACTTTGTTTATTATA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CTGGCCTTAGCAAATGCAAACAGAGATGAATTTCTGACTAAACCAGAGGTAGCCAGAAGA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AGCAGAATAACTAAAAATGTGCCTAAACAAAGCTCTCAGCTTGATGAGGATCGAACAGAG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GCTGCAAATAGAATAATATGTACTATCAGAAGTAGGAGACCTCAGATGGTCAGAAGTGTT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GAGGCACTTTGTGATGCTTATATTATATTAGCAAACTTAGATGCCACTCAGTGGAAGACT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CAGAGAAAAGGCATAAATATTCCAGCAGACCAGCCAATTACTAAACTTAAGAATTTAGAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GATGTTGTTGTCCCTACTATGGAAATTAAGGTGGACCACACAGGAGAATATGGAAATCTG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GTGACTATACAGTCATTTAAAGCAGAATTTCGCTTAGCAGGAGGTGTAAATTTACCAAAA
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ATAATAGATTGTGTAGGTTCCGATGGCAAGGAGAGGAGACAGCTTGTTAAGGGCCGTGAT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GACCTGAGACAAGATGCTGTCATGCAACAGGTCTTCCAGATGTGTAATACATTACTGCAG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AGAAACACGGAAACTAGGAAGAGGAAATTAACTATCTGTACTTATAAGGTGGTTCCCCTC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TCTCAGCGAAGTGGTGTTCTTGAATGGTGCACAGGAACTGTCCCCATTGGTGAATTTCTT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GTTAACAATGAAGATGGTGCTCATAAAAGATACAGGCCAAATGATTTCAGTGCCTTTCAG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TGCCAAAAGAAAATGATGGAGGTGCAAAAAAAGTCTTTTGAAGAGAAATATGAAGTCTTC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ATGGATGTTTGCCAAAATTTTCAACCAGTTTTCCGTTACTTCTGCATGGAAAAATTCTTG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GATCCAGCTATTTGGTTTGAGAAGCGATTGGCTTATACGCGCAGTGTAGCTACTTCTTCT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ATTGTTGGTTACATACTTGGACTTGGTGATAGACATGTACAGAATATCTTGATAAATGAG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CAGTCAGCAGAACTTGTACATATAGATCTAGGTGTTGCTTTTGAACAGGGCAAAATCCTT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CCTACTCCTGAGACAGTTCCTTTTAGACTCACCAGAGATATTGTGGATGGCATGGGCATT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ACGGGTGTTGAAGGTGTCTTCAGAAGATGCTGTGAGAAAACCATGGAAGTGATGAGAAAC
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       TCTCAGGAAACTCTGTTAACCATTGTAGAGGTCCTTCTATATGATCCACTCTTTGACTGG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       ACCATGAATCCTTTGAAAGCTTTGTATTTACAGCAGAGGCCGGAAGATGAAACTGAGCTT
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       CACCCTACTCTGAATGCAGATGACCAAGAATGCAAACGAAATCTCAGTGATATTGACCAG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       AGTTTCAACAAAGTAGCTGAACGTGTCTTAATGAGACTACAAGAGAAACTGAAAGGAGTG
                                                                              

HsCD00513726      ------------------------------------------------------------
NM_000051.3       GAAGAAGGCACTGTGCTCAGTGTTGGTGGACAAGTGAATTTGCTCATACAGCAGGCCATA
                                                                              

HsCD00513726      ---------------------------------------------------
NM_000051.3       GACCCCAAAAATCTCAGCCGACTTTTCCCAGGATGGAAAGCTTGGGTGTGA
                                                                     

Pathways

NCI : ATM pathway
NCI : BARD1 signaling events
NCI : Canonical NF-kappaB pathway
NCI : E2F transcription factor network
NCI : Fanconi anemia pathway
NCI : Regulation of Telomerase
NCI : Validated transcriptional targets of deltaNp63 isoforms
NCI : p38 MAPK signaling pathway
NCI : p53 pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : ATM mediated phosphorylation of repair proteins
Reactome : ATM mediated response to DNA double-strand break
Reactome : Autodegradation of the E3 ubiquitin ligase COP1
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cellular Senescence
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Fanconi Anemia pathway
Reactome : G1/S DNA Damage Checkpoints
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of the Fanconi anemia pathway
Reactome : Stabilization of p53
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : G1 to S cell cycle control
WikiPathway : Homologous recombination
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Ovarian Infertility Genes
WikiPathway : TP53 network
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

HPRD : 06347

Clone

Cloning Information : 667834
Original Clone ID : ccsbBroadEn_10689

Organism


TAX_ID : 9606
Species Specific ID: 472

Genome

Chromosome : 11
Map Location : 11q22-q23
Ensembl : ENSG00000149311

Reagents

Labome : ATM-antibody