DNASU Plasmid Repository • 480.965.5697 | Email

DTX4 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  DTX4
Gene Name:  deltex 4, E3 ubiquitin ligase
Sequence             
Original Clone ID: ccsbBroadEn_11698
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC119011.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00513854

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1540nts         Open reading frame : 1 to 1540
Reference Sequence Alignment

ATGGAAGTGGGCATCACCATCCAGCATGCCTATGAGAAGCAGCACCCCTGGATCGACCTC
ACTTCCATTGGCTTTAGCTACGTAATTGACTTCAACACCATGGGCCAGATCAACCGTCAG
ACCCAGCGCCAACGCCGCGTCCGCCGGCGCCTCGACCTCATCTACCCCATGGTCACAGGG
ACCTTGCCTAAGGCTCAGTCCTGGCCAGTCAGCCCTGGGCCAGCCACCTCGCCCCCCATG
TCCCCCTGCTCCTGTCCCCAGTGTGTCTTGGTGATGAGTGTTAAGGCAGCCGTGGTCAAT
GGCAGCACTGGGCCCCTACAGCTGCCAGTGACCCGCAAGAACATGCCGCCTCCTGGAGTG
GTCAAGCTACCCCCACTGCCAGGCTCTGGGGCCAAGCCACTGGACAGCACAGGCACCATT
CGAGGCCCACTGAAGACCGCCCCATCGCAGGTGATCCGGAGACAAGCCTCCAGCATGCCC
ACTGGGACAACCATGGGCTCTCCTGCCAGTCCCCCAGGACCCAACAGCAAGACCGGAAGG
GTGGCCCTGGCCACCTTGAATCGTACCAACCTGCAGCGACTGGCCATTGCCCAGTCCCGG
GTGCTGATCGCCTCTGGGGTCCCCACAGTCCCAGTGAAGAACCTAAATGGGTCCAGTCCT
GTCAACCCTGCCTTGGCAGGAATCACTGGGATCCTCATGAGTGCAGCGGGGCTGCCTGTG
TGTCTCACCAGGCCACCAAAGCTGGTCCTACACCCACCCCCCGTCAGCAAGAGTGAAATA
AAATCCATCCCAGGGGTTTCCAACACAAGCCGCAAGACCACCAAAAAACAAGCCAAGAAA
GGTAAAACCCCAGAGGAAGTGCTAAAAAAATATCTACAGAAAGTCCGGCACCCACCAGAT
GAGGACTGCACCATCTGTATGGAACGCCTCACGGCCCCCTCAGGCTACAAGGGCCCGCAG
CCTACGGTAAAACCTGACCTGGTAGGGAAGCTGTCCAGATGCGGCCACGTCTACCACATC
TACTGCTTGGTTGCCATGTACAACAATGGGAACAAGGATGGAAGTTTGCAGTGTCCAACC
TGCAAGACCATTTATGGGGTGAAGACAGGCACCCAACCTCCAGGGAAGATGGAGTACCAC
CTCATCCCCCACTCCTTGCCTGGCCACCCAGACTGCAAAACCATCCGGATCATCTACAGC
ATCCCCCCCGGCATTCAGGGACCGGAACACCCGAATCCTGGGAAGAGTTTCAGCGCCCGA
GGCTTCCCACGACACTGTTACCTTCCGGACAGCGAGAAAGGGAGAAAAGTTCTGAAGCTG
CTGCTCGTGGCCTGGGATCGCCGCCTCATTTTTGCCATTGGCACCTCCAGCACCACAGGC
GAGTCAGACACCGTCATCTGGAATGAGGTCCACCACAAGACAGAGTTTGGCTCTAATCTC
ACTGGCCATGGCTACCCAGATGCCAATTACCTGGATAATGTGCTGGCTGAACTGGCTGCC
CAGGGCATCTCTGAGGACAGCACTGCCCAGGAGAAGGAC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : DTX4
Symbol Nomenclature : DTX4
SYNONYM : RNF155
Designation : E3 ubiquitin-protein ligase DTX4|RING finger protein 155|deltex 4 homolog|deltex homolog 4|deltex4|protein deltex-4
Full Nomenclature : deltex 4, E3 ubiquitin ligase
GENEID : 23220
HGNC : 29151
Vega : OTTHUMG00000167336
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00513854      ------------------------------------------------------------
NM_015177.1       ATGCTCCTGGCCTCGGCCGTGGTGGTCTGGGAATGGCTGAACGAGCACGGCCGCTGGCGT
                                                                              

HsCD00513854      ------------------------------------------------------------
NM_015177.1       CCCTACAGCCCAGCGGTGAGCCACCACATCGAGGCGGTGGTCCGCGCCGGCCCCCGCGCG
                                                                              

HsCD00513854      ------------------------------------------------------------
NM_015177.1       GGGGGCAGCGTGGTGCTGGGCCAGGTGGACAGCCGTCTCGCGCCCTACATCATCGACCTG
                                                                              

HsCD00513854      ------------------------------------------------------------
NM_015177.1       CAGTCCATGAACCAGTTCCGCCAAGACACGGGAACTCTCCGCCCAGTTCGCCGCAACTAC
                                                                              

HsCD00513854      ------------------------------------------------------------
NM_015177.1       TACGACCCCTCCTCGGCCCCTGGGAAGGGCGTGGTGTGGGAGTGGGAGAACGACAATGGC
                                                                              

HsCD00513854      ------------------ATGGAAGTGGGCATCACCATCCAGCATGCCTATGAGAAGCAG
NM_015177.1       TCCTGGACGCCCTACGACATGGAAGTGGGCATCACCATCCAGCATGCCTATGAGAAGCAG
                                    ******************************************

HsCD00513854      CACCCCTGGATCGACCTCACTTCCATTGGCTTTAGCTACGTAATTGACTTCAACACCATG
NM_015177.1       CACCCCTGGATCGACCTCACTTCCATTGGCTTTAGCTACGTAATTGACTTCAACACCATG
                  ************************************************************

HsCD00513854      GGCCAGATCAACCGTCAGACCCAGCGCCAACGCCGCGTCCGCCGGCGCCTCGACCTCATC
NM_015177.1       GGCCAGATCAACCGTCAGACCCAGCGCCAACGCCGCGTCCGCCGGCGCCTCGACCTCATC
                  ************************************************************

HsCD00513854      TACCCCATGGTCACAGGGACCTTGCCTAAGGCTCAGTCCTGGCCAGTCAGCCCTGGGCCA
NM_015177.1       TACCCCATGGTCACAGGGACCTTGCCTAAGGCTCAGTCCTGGCCAGTCAGCCCTGGGCCA
                  ************************************************************

HsCD00513854      GCCACCTCGCCCCCCATGTCCCCCTGCTCCTGTCCCCAGTGTGTCTTGGTGATGAGTGTT
NM_015177.1       GCCACCTCGCCCCCCATGTCCCCCTGCTCCTGTCCCCAGTGTGTCTTGGTGATGAGTGTT
                  ************************************************************

HsCD00513854      AAGGCAGCCGTGGTCAATGGCAGCACTGGGCCCCTACAGCTGCCAGTGACCCGCAAGAAC
NM_015177.1       AAGGCAGCCGTGGTCAATGGCAGCACTGGGCCCCTACAGCTGCCAGTGACCCGCAAGAAC
                  ************************************************************

HsCD00513854      ATGCCGCCTCCTGGAGTGGTCAAGCTACCCCCACTGCCAGGCTCTGGGGCCAAGCCACTG
NM_015177.1       ATGCCGCCTCCTGGAGTGGTCAAGCTACCCCCACTGCCAGGCTCTGGGGCCAAGCCACTG
                  ************************************************************

HsCD00513854      GACAGCACAGGCACCATTCGAGGCCCACTGAAGACCGCCCCATCGCAGGTGATCCGGAGA
NM_015177.1       GACAGCACAGGCACCATTCGAGGCCCACTGAAGACCGCCCCATCGCAGGTGATCCGGAGA
                  ************************************************************

HsCD00513854      CAAGCCTCCAGCATGCCCACTGGGACAACCATGGGCTCTCCTGCCAGTCCCCCAGGACCC
NM_015177.1       CAAGCCTCCAGCATGCCCACTGGGACAACCATGGGCTCTCCTGCCAGTCCCCCAGGACCC
                  ************************************************************

HsCD00513854      AACAGCAAGACCGGAAGGGTGGCCCTGGCCACCTTGAATCGTACCAACCTGCAGCGACTG
NM_015177.1       AACAGCAAGACCGGAAGGGTGGCCCTGGCCACCTTGAATCGTACCAACCTGCAGCGACTG
                  ************************************************************

HsCD00513854      GCCATTGCCCAGTCCCGGGTGCTGATCGCCTCTGGGGTCCCCACAGTCCCAGTGAAGAAC
NM_015177.1       GCCATTGCCCAGTCCCGGGTGCTGATCGCCTCTGGGGTCCCCACAGTCCCAGTGAAGAAC
                  ************************************************************

HsCD00513854      CTAAATGGGTCCAGTCCTGTCAACCCTGCCTTGGCAGGAATCACTGGGATCCTCATGAGT
NM_015177.1       CTAAATGGGTCCAGTCCTGTCAACCCTGCCTTGGCAGGAATCACTGGGATCCTCATGAGT
                  ************************************************************

HsCD00513854      GCAGCGGGGCTGCCTGTGTGTCTCACCAGGCCACCAAAGCTGGTCCTACACCCACCCCCC
NM_015177.1       GCAGCGGGGCTGCCTGTGTGTCTCACCAGGCCACCAAAGCTGGTCCTACACCCACCCCCC
                  ************************************************************

HsCD00513854      GTCAGCAAGAGTGAAATAAAATCCATCCCAGGGGTTTCCAACACAAGCCGCAAGACCACC
NM_015177.1       GTCAGCAAGAGTGAAATAAAATCCATCCCAGGGGTTTCCAACACAAGCCGCAAGACCACC
                  ************************************************************

HsCD00513854      AAAAAACAAGCCAAGAAAGGTAAAACCCCAGAGGAAGTGCTAAAAAAATATCTACAGAAA
NM_015177.1       AAAAAACAAGCCAAGAAAGGTAAAACCCCAGAGGAAGTGCTAAAAAAATATCTACAGAAA
                  ************************************************************

HsCD00513854      GTCCGGCACCCACCAGATGAGGACTGCACCATCTGTATGGAACGCCTCACGGCCCCCTCA
NM_015177.1       GTCCGGCACCCACCAGATGAGGACTGCACCATCTGTATGGAACGCCTCACGGCCCCCTCA
                  ************************************************************

HsCD00513854      GGCTACAAGGGCCCGCAGCCTACGGTAAAACCTGACCTGGTAGGGAAGCTGTCCAGATGC
NM_015177.1       GGCTACAAGGGCCCGCAGCCTACGGTAAAACCTGACCTGGTAGGGAAGCTGTCCAGATGC
                  ************************************************************

HsCD00513854      GGCCACGTCTACCACATCTACTGCTTGGTTGCCATGTACAACAATGGGAACAAGGATGGA
NM_015177.1       GGCCACGTCTACCACATCTACTGCTTGGTTGCCATGTACAACAATGGGAACAAGGATGGA
                  ************************************************************

HsCD00513854      AGTTTGCAGTGTCCAACCTGCAAGACCATTTATGGGGTGAAGACAGGCACCCAACCTCCA
NM_015177.1       AGTTTGCAGTGTCCAACCTGCAAGACCATTTATGGGGTGAAGACAGGCACCCAACCTCCA
                  ************************************************************

HsCD00513854      GGGAAGATGGAGTACCACCTCATCCCCCACTCCTTGCCTGGCCACCCAGACTGCAAAACC
NM_015177.1       GGGAAGATGGAGTACCACCTCATCCCCCACTCCTTGCCTGGCCACCCAGACTGCAAAACC
                  ************************************************************

HsCD00513854      ATCCGGATCATCTACAGCATCCCCCCCGGCATTCAGGGACCGGAACACCCGAATCCTGGG
NM_015177.1       ATCCGGATCATCTACAGCATCCCCCCCGGCATTCAGGGACCGGAACACCCGAATCCTGGG
                  ************************************************************

HsCD00513854      AAGAGTTTCAGCGCCCGAGGCTTCCCACGACACTGTTACCTTCCGGACAGCGAGAAAGGG
NM_015177.1       AAGAGTTTCAGCGCCCGAGGCTTCCCACGACACTGTTACCTTCCGGACAGCGAGAAAGGG
                  ************************************************************

HsCD00513854      AGAAAAGTTCTGAAGCTGCTGCTCGTGGCCTGGGATCGCCGCCTCATTTTTGCCATTGGC
NM_015177.1       AGAAAAGTTCTGAAGCTGCTGCTCGTGGCCTGGGATCGCCGCCTCATTTTTGCCATTGGC
                  ************************************************************

HsCD00513854      ACCTCCAGCACCACAGGCGAGTCAGACACCGTCATCTGGAATGAGGTCCACCACAAGACA
NM_015177.1       ACCTCCAGCACCACAGGCGAGTCAGACACCGTCATCTGGAATGAGGTCCACCACAAGACA
                  ************************************************************

HsCD00513854      GAGTTTGGCTCTAATCTCACTGGCCATGGCTACCCAGATGCCAATTACCTGGATAATGTG
NM_015177.1       GAGTTTGGCTCTAATCTCACTGGCCATGGCTACCCAGATGCCAATTACCTGGATAATGTG
                  ************************************************************

HsCD00513854      CTGGCTGAACTGGCTGCCCAGGGCATCTCTGAGGACAGCACTGCCCAGGAGAAGGAC---
NM_015177.1       CTGGCTGAACTGGCTGCCCAGGGCATCTCTGAGGACAGCACTGCCCAGGAGAAGGACTGA
                  *********************************************************   

Pathways

Reactome : Activated NOTCH1 Transmits Signal to the Nucleus
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Disease
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : IRF3 mediated activation of type 1 IFN
Reactome : IRF3-mediated induction of type I IFN
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Regulation of innate immune responses to cytosolic DNA
Reactome : STING mediated induction of host immune responses
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
Reactome : ZBP1(DAI) mediated induction of type I IFNs
WikiPathway : Notch Signaling Pathway

Clone

Cloning Information : 669973
Original Clone ID : ccsbBroadEn_11698

Organism


TAX_ID : 9606
Species Specific ID: 23220

Genome

Chromosome : 11
Map Location : 11q12.1
Ensembl : ENSG00000110042

Reagents

Labome : DTX4-antibody