DNASU Plasmid Repository • 480.965.5697 | Email

ENC1 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ENC1
Gene Name:  ectodermal-neural cortex 1 (with BTB domain)
Sequence             
Original Clone ID: ccsbBroadEn_01942
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC000418.2
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00514076

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1768nts         Open reading frame : 1 to 1768
Reference Sequence Alignment

ATGTCAGTCAGTGTGCATGAGAACCGCAAGTCCAGGGCCAGCAGCGGCTCCATTAACATC
TATCTGTTTCACAAGTCCTCCTACGCTGACAGCGTCCTCACTCACCTGAATCTTTTACGC
CAGCAGCGTCTCTTCACTGACGTCCTTCTCCATGCCGGAAATAGGACCTTCCCTTGCCAC
CGGGCAGTGCTGGCTGCATGCAGTCGCTACTTTGAGGCCATGTTCAGTGGTGGCCTGAAA
GAGAGCCAGGACAGTGAGGTCAACTTTGACAATTCCATCCACCCAGAAGTCTTGGAGCTG
CTGCTTGACTATGCGTACTCCTCCCGGGTCATCATCAATGAAGAAAATGCAGAATCGCTC
CTGGAAGCTGGTGACATGCTGGAGTTTCAAGACATCCGGGATGCATGTGCAGAGTTCCTG
GAAAAGAACCTGCATCCCACCAACTGCCTGGGCATGCTGCTGCTGTCTGATGCACACCAG
TGCACCAAGCTGTACGAACTATCTTGGAGAATGTGTCTCAGCAACTTCCAAACCATCAGG
AAGAATGAAGATTTCCTCCAGCTGCCCCAGGACATGGTAGTGCAACTCTTGTCCAGTGAA
GAGCTGGAGACAGAGGATGAAAGGCTTGTGTACGAGTCTGCAATTAACTGGATCAGCTAT
GACCTGAAGAAGCGCTATTGCTACCTCCCAGAACTGTTGCAGACAGTAAGGCTGGCACTT
CTGCCAGCCATCTATCTCATGGAGAATGTGGCCATGGAGGAACTCATCACCAAGCAGAGA
AAGAGTAAGGAAATTGTGGAAGAGGCCATCAGGTGCAAACTGAAAATCCTGCAGAATGAC
GGTGTGGTAACCAGCCTCTGTGCCCGACCTCGGAAAACTGGCCATGCCCTCTTCCTTCTG
GGAGGACAGACTTTCATGTGTGACAAGTTGTATCTGGTAGACCAGAAGGCCAAAGAAATC
ATTCCCAAGGCTGACATTCCCAGCCCAAGAAAAGAGTTTAGTGCATGTGCGATTGGCTGC
AAAGTGTACATTACTGGGGGGCGGGGGTCTGAAAATGGGGTCTCAAAAGATGTCTGGGTT
TATGATACCCTGCACGAGGAGTGGTCCAAGGCTGCCCCCATGCTGGTGGCCAGGTTTGGC
CATGGCTCTGCTGAACTGAAGCACTGCCTGTATGTGGTTGGGGGGCACACGGCCGCAACT
GGCTGCCTCCCGGCCTCCCCCTCAGTCTCTCTAAAGCAGGTAGAACATTATGACCCCACA
ATCAACAAATGGACCATGGTGGCCCCACTCCGAGAAGGCGTTAGCAACGCCGCAGTAGTG
AGTGCCAAACTTAAGTTATTTGCTTTCGGAGGTACCAGTGTCAGTCATGACAAGCTCCCC
AAAGTTCAGTGTTACGATCAGTGTGAAAACAGGTGGACTGTACCGGCCACCTGTCCCCAG
CCCTGGCGTTACACAGCAGCAGCTGTGCTGGGGAACCAGATTTTTATTATGGGGGGTGAT
ACAGAATTCTCTGCCTGCTCTGCTTATAAATTCAACAGTGAGACTTACCAGTGGACCAAG
GTGGGAGATGTGACAGCAAAGCGCATGAGCTGCCATGCTGTGGCCTCTGGAAACAAACTC
TACGTGGTTGGAGGATACTTTGGCATTCAGCGATGCAAGACTTTGGACTGCTACGATCCA
ACATTAGACGTGTGGAACAGCATCACCACTGTCCCGTACTCGCTGATTCCTACTGCATTT
GTCAGCACCTGGAAACATCTGCCTTCT


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ENC1
Symbol Nomenclature : ENC1
SYNONYM : CCL28; ENC-1; KLHL35; KLHL37; NRPB; PIG10; TP53I10
Designation : ectoderm-neural cortex protein 1|ectodermal-neural cortex 1 (with BTB-like domain)|kelch-like 35|kelch-like family member 37|kelch-like protein 37|nuclear matrix protein NRP/B|nuclear restricted protein, BTB domain-like (brain)|p53-induced gene 10 protein|tumor protein p53 inducible protein 10
Full Nomenclature : ectodermal-neural cortex 1 (with BTB domain)
GENEID : 8507
GenBank Accession : EU831710
HGNC : 3345
MIM : 605173
Vega : OTTHUMG00000102059
Target GenBank: EU831710

 

Reference Sequence Alignment

  

HsCD00514076        ATGTCAGTCAGTGTGCATGAGAACCGCAAGTCCAGGGCCAGCAGCGGCTCCATTAACATC
NM_001256574.1      ATGTCAGTCAGTGTGCATGAGAACCGCAAGTCCAGGGCCAGCAGCGGCTCCATTAACATC
NM_003633.3         ATGTCAGTCAGTGTGCATGAGAACCGCAAGTCCAGGGCCAGCAGCGGCTCCATTAACATC
NM_001256575.1      ATGTCAGTCAGTGTGCATGAGAACCGCAAGTCCAGGGCCAGCAGCGGCTCCATTAACATC
                    ************************************************************

HsCD00514076        TATCTGTTTCACAAGTCCTCCTACGCTGACAGCGTCCTCACTCACCTGAATCTTTTACGC
NM_001256574.1      TATCTGTTTCACAAGTCCTCCTACGCTGACAGCGTCCTCACTCACCTGAATCTTTTACGC
NM_003633.3         TATCTGTTTCACAAGTCCTCCTACGCTGACAGCGTCCTCACTCACCTGAATCTTTTACGC
NM_001256575.1      TATCTGTTTCACAAGTCCTCCTACGCTGACAGCGTCCTCACTCACCTGAATCTTTTACGC
                    ************************************************************

HsCD00514076        CAGCAGCGTCTCTTCACTGACGTCCTTCTCCATGCCGGAAATAGGACCTTCCCTTGCCAC
NM_001256574.1      CAGCAGCGTCTCTTCACTGACGTCCTTCTCCATGCCGGAAATAGGACCTTCCCTTGCCAC
NM_003633.3         CAGCAGCGTCTCTTCACTGACGTCCTTCTCCATGCCGGAAATAGGACCTTCCCTTGCCAC
NM_001256575.1      CAGCAGCGTCTCTTCACTGACGTCCTTCTCCATGCCGGAAATAGGACCTTCCCTTGCCAC
                    ************************************************************

HsCD00514076        CGGGCAGTGCTGGCTGCATGCAGTCGCTACTTTGAGGCCATGTTCAGTGGTGGCCTGAAA
NM_001256574.1      CGGGCAGTGCTGGCTGCATGCAGTCGCTACTTTGAGGCCATGTTCAGTGGTGGCCTGAAA
NM_003633.3         CGGGCAGTGCTGGCTGCATGCAGTCGCTACTTTGAGGCCATGTTCAGTGGTGGCCTGAAA
NM_001256575.1      CGGGCAGTGCTGGCTGCATGCAGTCGCTACTTTGAGGCCATGTTCAGTGGTGGCCTGAAA
                    ************************************************************

HsCD00514076        GAGAGCCAGGACAGTGAGGTCAACTTTGACAATTCCATCCACCCAGAAGTCTTGGAGCTG
NM_001256574.1      GAGAGCCAGGACAGTGAGGTCAACTTTGACAATTCCATCCACCCAGAAGTCTTGGAGCTG
NM_003633.3         GAGAGCCAGGACAGTGAGGTCAACTTTGACAATTCCATCCACCCAGAAGTCTTGGAGCTG
NM_001256575.1      GAGAGCCAGGACAGTGAGGTCAACTTTGACAATTCCATCCACCCAGAAGTCTTGGAGCTG
                    ************************************************************

HsCD00514076        CTGCTTGACTATGCGTACTCCTCCCGGGTCATCATCAATGAAGAAAATGCAGAATCGCTC
NM_001256574.1      CTGCTTGACTATGCGTACTCCTCCCGGGTCATCATCAATGAAGAAAATGCAGAATCGCTC
NM_003633.3         CTGCTTGACTATGCGTACTCCTCCCGGGTCATCATCAATGAAGAAAATGCAGAATCGCTC
NM_001256575.1      CTGCTTGACTATGCGTACTCCTCCCGGGTCATCATCAATGAAGAAAATGCAGAATCGCTC
                    ************************************************************

HsCD00514076        CTGGAAGCTGGTGACATGCTGGAGTTTCAAGACATCCGGGATGCATGTGCAGAGTTCCTG
NM_001256574.1      CTGGAAGCTGGTGACATGCTGGAGTTTCAAGACATCCGGGATGCATGTGCAGAGTTCCTG
NM_003633.3         CTGGAAGCTGGTGACATGCTGGAGTTTCAAGACATCCGGGATGCATGTGCAGAGTTCCTG
NM_001256575.1      CTGGAAGCTGGTGACATGCTGGAGTTTCAAGACATCCGGGATGCATGTGCAGAGTTCCTG
                    ************************************************************

HsCD00514076        GAAAAGAACCTGCATCCCACCAACTGCCTGGGCATGCTGCTGCTGTCTGATGCACACCAG
NM_001256574.1      GAAAAGAACCTGCATCCCACCAACTGCCTGGGCATGCTGCTGCTGTCTGATGCACACCAG
NM_003633.3         GAAAAGAACCTGCATCCCACCAACTGCCTGGGCATGCTGCTGCTGTCTGATGCACACCAG
NM_001256575.1      GAAAAGAACCTGCATCCCACCAACTGCCTGGGCATGCTGCTGCTGTCTGATGCACACCAG
                    ************************************************************

HsCD00514076        TGCACCAAGCTGTACGAACTATCTTGGAGAATGTGTCTCAGCAACTTCCAAACCATCAGG
NM_001256574.1      TGCACCAAGCTGTACGAACTATCTTGGAGAATGTGTCTCAGCAACTTCCAAACCATCAGG
NM_003633.3         TGCACCAAGCTGTACGAACTATCTTGGAGAATGTGTCTCAGCAACTTCCAAACCATCAGG
NM_001256575.1      TGCACCAAGCTGTACGAACTATCTTGGAGAATGTGTCTCAGCAACTTCCAAACCATCAGG
                    ************************************************************

HsCD00514076        AAGAATGAAGATTTCCTCCAGCTGCCCCAGGACATGGTAGTGCAACTCTTGTCCAGTGAA
NM_001256574.1      AAGAATGAAGATTTCCTCCAGCTGCCCCAGGACATGGTAGTGCAACTCTTGTCCAGTGAA
NM_003633.3         AAGAATGAAGATTTCCTCCAGCTGCCCCAGGACATGGTAGTGCAACTCTTGTCCAGTGAA
NM_001256575.1      AAGAATGAAGATTTCCTCCAGCTGCCCCAGGACATGGTAGTGCAACTCTTGTCCAGTGAA
                    ************************************************************

HsCD00514076        GAGCTGGAGACAGAGGATGAAAGGCTTGTGTACGAGTCTGCAATTAACTGGATCAGCTAT
NM_001256574.1      GAGCTGGAGACAGAGGATGAAAGGCTTGTGTACGAGTCTGCAATTAACTGGATCAGCTAT
NM_003633.3         GAGCTGGAGACAGAGGATGAAAGGCTTGTGTACGAGTCTGCAATTAACTGGATCAGCTAT
NM_001256575.1      GAGCTGGAGACAGAGGATGAAAGGCTTGTGTACGAGTCTGCAATTAACTGGATCAGCTAT
                    ************************************************************

HsCD00514076        GACCTGAAGAAGCGCTATTGCTACCTCCCAGAACTGTTGCAGACAGTAAGGCTGGCACTT
NM_001256574.1      GACCTGAAGAAGCGCTATTGCTACCTCCCAGAACTGTTGCAGACAGTAAGGCTGGCACTT
NM_003633.3         GACCTGAAGAAGCGCTATTGCTACCTCCCAGAACTGTTGCAGACAGTAAGGCTGGCACTT
NM_001256575.1      GACCTGAAGAAGCGCTATTGCTACCTCCCAGAACTGTTGCAGACAGTAAGGCTGGCACTT
                    ************************************************************

HsCD00514076        CTGCCAGCCATCTATCTCATGGAGAATGTGGCCATGGAGGAACTCATCACCAAGCAGAGA
NM_001256574.1      CTGCCAGCCATCTATCTCATGGAGAATGTGGCCATGGAGGAACTCATCACCAAGCAGAGA
NM_003633.3         CTGCCAGCCATCTATCTCATGGAGAATGTGGCCATGGAGGAACTCATCACCAAGCAGAGA
NM_001256575.1      CTGCCAGCCATCTATCTCATGGAGAATGTGGCCATGGAGGAACTCATCACCAAGCAGAGA
                    ************************************************************

HsCD00514076        AAGAGTAAGGAAATTGTGGAAGAGGCCATCAGGTGCAAACTGAAAATCCTGCAGAATGAC
NM_001256574.1      AAGAGTAAGGAAATTGTGGAAGAGGCCATCAGGTGCAAACTGAAAATCCTGCAGAATGAC
NM_003633.3         AAGAGTAAGGAAATTGTGGAAGAGGCCATCAGGTGCAAACTGAAAATCCTGCAGAATGAC
NM_001256575.1      AAGAGTAAGGAAATTGTGGAAGAGGCCATCAGGTGCAAACTGAAAATCCTGCAGAATGAC
                    ************************************************************

HsCD00514076        GGTGTGGTAACCAGCCTCTGTGCCCGACCTCGGAAAACTGGCCATGCCCTCTTCCTTCTG
NM_001256574.1      GGTGTGGTAACCAGCCTCTGTGCCCGACCTCGGAAAACTGGCCATGCCCTCTTCCTTCTG
NM_003633.3         GGTGTGGTAACCAGCCTCTGTGCCCGACCTCGGAAAACTGGCCATGCCCTCTTCCTTCTG
NM_001256575.1      GGTGTGGTAACCAGCCTCTGTGCCCGACCTCGGAAAACTGGCCATGCCCTCTTCCTTCTG
                    ************************************************************

HsCD00514076        GGAGGACAGACTTTCATGTGTGACAAGTTGTATCTGGTAGACCAGAAGGCCAAAGAAATC
NM_001256574.1      GGAGGACAGACTTTCATGTGTGACAAGTTGTATCTGGTAGACCAGAAGGCCAAAGAAATC
NM_003633.3         GGAGGACAGACTTTCATGTGTGACAAGTTGTATCTGGTAGACCAGAAGGCCAAAGAAATC
NM_001256575.1      GGAGGACAGACTTTCATGTGTGACAAGTTGTATCTGGTAGACCAGAAGGCCAAAGAAATC
                    ************************************************************

HsCD00514076        ATTCCCAAGGCTGACATTCCCAGCCCAAGAAAAGAGTTTAGTGCATGTGCGATTGGCTGC
NM_001256574.1      ATTCCCAAGGCTGACATTCCCAGCCCAAGAAAAGAGTTTAGTGCATGTGCGATTGGCTGC
NM_003633.3         ATTCCCAAGGCTGACATTCCCAGCCCAAGAAAAGAGTTTAGTGCATGTGCGATTGGCTGC
NM_001256575.1      ATTCCCAAGGCTGACATTCCCAGCCCAAGAAAAGAGTTTAGTGCATGTGCGATTGGCTGC
                    ************************************************************

HsCD00514076        AAAGTGTACATTACTGGGGGGCGGGGGTCTGAAAATGGGGTCTCAAAAGATGTCTGGGTT
NM_001256574.1      AAAGTGTACATTACTGGGGGGCGGGGGTCTGAAAATGGGGTCTCAAAAGATGTCTGGGTT
NM_003633.3         AAAGTGTACATTACTGGGGGGCGGGGGTCTGAAAATGGGGTCTCAAAAGATGTCTGGGTT
NM_001256575.1      AAAGTGTACATTACTGGGGGGCGGGGGTCTGAAAATGGGGTCTCAAAAGATGTCTGGGTT
                    ************************************************************

HsCD00514076        TATGATACCCTGCACGAGGAGTGGTCCAAGGCTGCCCCCATGCTGGTGGCCAGGTTTGGC
NM_001256574.1      TATGATACCCTGCACGAGGAGTGGTCCAAGGCTGCCCCCATGCTGGTGGCCAGGTTTGGC
NM_003633.3         TATGATACCCTGCACGAGGAGTGGTCCAAGGCTGCCCCCATGCTGGTGGCCAGGTTTGGC
NM_001256575.1      TATGATACCCTGCACGAGGAGTGGTCCAAGGCTGCCCCCATGCTGGTGGCCAGGTTTGGC
                    ************************************************************

HsCD00514076        CATGGCTCTGCTGAACTGAAGCACTGCCTGTATGTGGTTGGGGGGCACACGGCCGCAACT
NM_001256574.1      CATGGCTCTGCTGAACTGAAGCACTGCCTGTATGTGGTTGGGGGGCACACGGCCGCAACT
NM_003633.3         CATGGCTCTGCTGAACTGAAGCACTGCCTGTATGTGGTTGGGGGGCACACGGCCGCAACT
NM_001256575.1      CATGGCTCTGCTGAACTGAAGCACTGCCTGTATGTGGTTGGGGGGCACACGGCCGCAACT
                    ************************************************************

HsCD00514076        GGCTGCCTCCCGGCCTCCCCCTCAGTCTCTCTAAAGCAGGTAGAACATTATGACCCCACA
NM_001256574.1      GGCTGCCTCCCGGCCTCCCCCTCAGTCTCTCTAAAGCAGGTAGAACATTATGACCCCACA
NM_003633.3         GGCTGCCTCCCGGCCTCCCCCTCAGTCTCTCTAAAGCAGGTAGAACATTATGACCCCACA
NM_001256575.1      GGCTGCCTCCCGGCCTCCCCCTCAGTCTCTCTAAAGCAGGTAGAACATTATGACCCCACA
                    ************************************************************

HsCD00514076        ATCAACAAATGGACCATGGTGGCCCCACTCCGAGAAGGCGTTAGCAACGCCGCAGTAGTG
NM_001256574.1      ATCAACAAATGGACCATGGTGGCCCCACTCCGAGAAGGCGTTAGCAACGCCGCAGTAGTG
NM_003633.3         ATCAACAAATGGACCATGGTGGCCCCACTCCGAGAAGGCGTTAGCAACGCCGCAGTAGTG
NM_001256575.1      ATCAACAAATGGACCATGGTGGCCCCACTCCGAGAAGGCGTTAGCAACGCCGCAGTAGTG
                    ************************************************************

HsCD00514076        AGTGCCAAACTTAAGTTATTTGCTTTCGGAGGTACCAGTGTCAGTCATGACAAGCTCCCC
NM_001256574.1      AGTGCCAAACTTAAGTTATTTGCTTTCGGAGGTACCAGTGTCAGTCATGACAAGCTCCCC
NM_003633.3         AGTGCCAAACTTAAGTTATTTGCTTTCGGAGGTACCAGTGTCAGTCATGACAAGCTCCCC
NM_001256575.1      AGTGCCAAACTTAAGTTATTTGCTTTCGGAGGTACCAGTGTCAGTCATGACAAGCTCCCC
                    ************************************************************

HsCD00514076        AAAGTTCAGTGTTACGATCAGTGTGAAAACAGGTGGACTGTACCGGCCACCTGTCCCCAG
NM_001256574.1      AAAGTTCAGTGTTACGATCAGTGTGAAAACAGGTGGACTGTACCGGCCACCTGTCCCCAG
NM_003633.3         AAAGTTCAGTGTTACGATCAGTGTGAAAACAGGTGGACTGTACCGGCCACCTGTCCCCAG
NM_001256575.1      AAAGTTCAGTGTTACGATCAGTGTGAAAACAGGTGGACTGTACCGGCCACCTGTCCCCAG
                    ************************************************************

HsCD00514076        CCCTGGCGTTACACAGCAGCAGCTGTGCTGGGGAACCAGATTTTTATTATGGGGGGTGAT
NM_001256574.1      CCCTGGCGTTACACAGCAGCAGCTGTGCTGGGGAACCAGATTTTTATTATGGGGGGTGAT
NM_003633.3         CCCTGGCGTTACACAGCAGCAGCTGTGCTGGGGAACCAGATTTTTATTATGGGGGGTGAT
NM_001256575.1      CCCTGGCGTTACACAGCAGCAGCTGTGCTGGGGAACCAGATTTTTATTATGGGGGGTGAT
                    ************************************************************

HsCD00514076        ACAGAATTCTCTGCCTGCTCTGCTTATAAATTCAACAGTGAGACTTACCAGTGGACCAAG
NM_001256574.1      ACAGAATTCTCTGCCTGCTCTGCTTATAAATTCAACAGTGAGACTTACCAGTGGACCAAG
NM_003633.3         ACAGAATTCTCTGCCTGCTCTGCTTATAAATTCAACAGTGAGACTTACCAGTGGACCAAG
NM_001256575.1      ACAGAATTCTCTGCCTGCTCTGCTTATAAATTCAACAGTGAGACTTACCAGTGGACCAAG
                    ************************************************************

HsCD00514076        GTGGGAGATGTGACAGCAAAGCGCATGAGCTGCCATGCTGTGGCCTCTGGAAACAAACTC
NM_001256574.1      GTGGGAGATGTGACAGCAAAGCGCATGAGCTGCCATGCTGTGGCCTCTGGAAACAAACTC
NM_003633.3         GTGGGAGATGTGACAGCAAAGCGCATGAGCTGCCATGCTGTGGCCTCTGGAAACAAACTC
NM_001256575.1      GTGGGAGATGTGACAGCAAAGCGCATGAGCTGCCATGCTGTGGCCTCTGGAAACAAACTC
                    ************************************************************

HsCD00514076        TACGTGGTTGGAGGATACTTTGGCATTCAGCGATGCAAGACTTTGGACTGCTACGATCCA
NM_001256574.1      TACGTGGTTGGAGGATACTTTGGCATTCAGCGATGCAAGACTTTGGACTGCTACGATCCA
NM_003633.3         TACGTGGTTGGAGGATACTTTGGCATTCAGCGATGCAAGACTTTGGACTGCTACGATCCA
NM_001256575.1      TACGTGGTTGGAGGATACTTTGGCATTCAGCGATGCAAGACTTTGGACTGCTACGATCCA
                    ************************************************************

HsCD00514076        ACATTAGACGTGTGGAACAGCATCACCACTGTCCCGTACTCGCTGATTCCTACTGCATTT
NM_001256574.1      ACATTAGACGTGTGGAACAGCATCACCACTGTCCCGTACTCGCTGATTCCTACTGCATTT
NM_003633.3         ACATTAGACGTGTGGAACAGCATCACCACTGTCCCGTACTCGCTGATTCCTACTGCATTT
NM_001256575.1      ACATTAGACGTGTGGAACAGCATCACCACTGTCCCGTACTCGCTGATTCCTACTGCATTT
                    ************************************************************

HsCD00514076        GTCAGCACCTGGAAACATCTGCCTTCT---
NM_001256574.1      GTCAGCACCTGGAAACATCTGCCTTCTTAA
NM_003633.3         GTCAGCACCTGGAAACATCTGCCTTCTTAA
NM_001256575.1      GTCAGCACCTGGAAACATCTGCCTTCTTAA
                    ***************************   

Protein

SMART domain : Kelch :
SMART domain : BACK : BTB And C-terminal Kelch
SMART domain : BTB : Broad-Complex, Tramtrack and Bric a brac
HPRD : 05529

Clone

Cloning Information : 607056
Original Clone ID : ccsbBroadEn_01942

Organism


TAX_ID : 9606
Species Specific ID: 8507

Genome

Chromosome : 5
Map Location : 5q13
Ensembl : ENSG00000171617

Reagents

Labome : ENC1-antibody