DNASU Plasmid Repository • 480.965.5697 | Email

IRAK2 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IRAK2
Gene Name:  interleukin-1 receptor-associated kinase 2
Sequence             
Original Clone ID: ccsbBroadEn_00879
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC125184.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00514292

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1876nts         Open reading frame : 1 to 1876
Reference Sequence Alignment

ATGGCCTGCTACATCTACCAGCTGCCCTCCTGGGTGCTGGACGACCTGTGCCGCAACATG
GACGCGCTCAGCGAGTGGGACTGGATGGAGTTCGCCTCCTACGTGATCACAGACCTGACC
CAGCTGCGGAAGATCAAGTCCATGGAGCGGGTGCAGGGTGTGAGCATCACGCGGGAGCTG
CTGTGGTGGTGGGGCATGCGGCAGGCCACCGTCCAGCAACTTGTGGACCTCCTGTGCCGC
CTGGAGCTCTACCGGGCTGCCCAGATCATCCTGAACTGGAAACCGGCTCCTGAAATCAGG
TGTCCCATTCCAGCCTTCCCTGACTCTGTGAAGCCAGAAAAGCCTTTGGCAGCTTCTGTA
AGAAAGGCTGAGGATGAACAGGAAGAGGGGCAGCCTGTGAGGATGGCCACCTTTCCAGGC
CCAGGGTCCTCTCCAGCCAGAGCCCACCAGCCGGCCTTTCTCCAGCCTCCTGAAGAAGAT
GCCCCTCATTCCTTGAGAAGCGACCTCCCCACTTCGTCTGATTCAAAGGACTTCAGCACC
TCCATTCCTAAGCAGGAAAAACTTTTGAGCTTGGCTGGAGACAGCCTTTTCTGGAGTGAG
GCAGACGTGGTCCAGGCAACCGATGACTTCAATCAAAACCGCAAAATCAGCCAGGGGACC
TTTGCTGACGTCTACAGAGGGCACAGGCACGGGAAGCCATTCGTCTTCAAGAAGCTCAGA
GAGACAGCCTGTTCAAGTCCAGGATCAATCGAAAGATTCTTCCAGGCAGAGTTGCAGATT
TGTCTTAGATGCTGCCACCCCAATGTCTTACCTGTGCTGGGCTTCTGTGCTGCAAGACAG
TTTCACAGCTTCATCTACCCCTACATGGCAAATGGTTCCCTACAGGACAGACTGCAGGGT
CAGGGTGGCTCGGACCCCCTCCCCTGGCCCCAGCGTGTCAGCATCTGCTCAGGGCTGCTC
TGTGCCGTCGAGTACCTGCATGGTCTGGAGATCATCCACAGCAACGTCAAGAGCTCTAAT
GTCTTGCTGGACCAAAATCTCACCCCCAAACTTGCTCACCCAATGGCTCATCTGTGTCCT
GTCAACAAAAGGTCAAAATACACCATGATGAAGACTCACCTGCTCCGGACGTCAGCCGCG
TATCTGCCAGAGGATTTCATCCGGGTGGGGCAGCTGACAAAGCGAGTGGACATCTTCAGC
TGTGGAATAGTGTTGGCCGAGGTCCTCACGGGCATCCCTGCAATGGATAACAACCGAAGC
CCGGTTTACCTGAAGGACTTACTCCTCAGTGATATTCCAAGCAGCACCGCCTCGCTCTGC
TCCAGGAAGACGGGCGTGGAGAACGTGATGGCAAAGGAGATCTGCCAGAAGTACCTGGAG
AAGGGCGCAGGGAGGCTTCCGGAGGACTGCGCCGAGGCCCTGGCCACGGCTGCCTGCCTG
TGCCTGCGGAGGCGTAACACCAGCCTGCAGGAGGTGTGTGGCTCTGTGGCTGCTGTGGAA
GAGCGGCTCCGAGGTCGGGAGACGTTGCTCCCTTGGAGTGGGCTTTCTGAGGGTACAGGC
TCTTCTTCCAACACCCCAGAGGAAACAGACGACGTTGACAATTCCAGCCTTGATGCCTCC
TCCTCCATGAGTGTGGCACCCTGGGCAGGGGCTGCCACCCCACTTCTCCCCACAGAGAAT
GGGGAAGGAAGGCTGCGGGTCATCGTGGGAAGGGAGGCTGACTCCTCCTCTGAGGCCTGT
GTTGGCCTGGAGCCTCCCCAGGATGTTACAGAAACTTCGTGGCAAATTGAGATCAATGAG
GCCAAAAGGAAACTGATGGAGAATATTCTGCTCTACAAAGAGGAAAAAGTGGACAGCATT
GAGCTCTTTGGCCCC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IRAK2
Symbol Nomenclature : IRAK2
SYNONYM : IRAK-2
Designation : interleukin-1 receptor associated kinase-2|interleukin-1 receptor-associated kinase-like 2
Full Nomenclature : interleukin-1 receptor-associated kinase 2
GENEID : 3656
HGNC : 6113
MIM : 603304
Vega : OTTHUMG00000155358
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00514292      ATGGCCTGCTACATCTACCAGCTGCCCTCCTGGGTGCTGGACGACCTGTGCCGCAACATG
NM_001570.3       ATGGCCTGCTACATCTACCAGCTGCCCTCCTGGGTGCTGGACGACCTGTGCCGCAACATG
                  ************************************************************

HsCD00514292      GACGCGCTCAGCGAGTGGGACTGGATGGAGTTCGCCTCCTACGTGATCACAGACCTGACC
NM_001570.3       GACGCGCTCAGCGAGTGGGACTGGATGGAGTTCGCCTCCTACGTGATCACAGACCTGACC
                  ************************************************************

HsCD00514292      CAGCTGCGGAAGATCAAGTCCATGGAGCGGGTGCAGGGTGTGAGCATCACGCGGGAGCTG
NM_001570.3       CAGCTGCGGAAGATCAAGTCCATGGAGCGGGTGCAGGGTGTGAGCATCACGCGGGAGCTG
                  ************************************************************

HsCD00514292      CTGTGGTGGTGGGGCATGCGGCAGGCCACCGTCCAGCAACTTGTGGACCTCCTGTGCCGC
NM_001570.3       CTGTGGTGGTGGGGCATGCGGCAGGCCACCGTCCAGCAACTTGTGGACCTCCTGTGCCGC
                  ************************************************************

HsCD00514292      CTGGAGCTCTACCGGGCTGCCCAGATCATCCTGAACTGGAAACCGGCTCCTGAAATCAGG
NM_001570.3       CTGGAGCTCTACCGGGCTGCCCAGATCATCCTGAACTGGAAACCGGCTCCTGAAATCAGG
                  ************************************************************

HsCD00514292      TGTCCCATTCCAGCCTTCCCTGACTCTGTGAAGCCAGAAAAGCCTTTGGCAGCTTCTGTA
NM_001570.3       TGTCCCATTCCAGCCTTCCCTGACTCTGTGAAGCCAGAAAAGCCTTTGGCAGCTTCTGTA
                  ************************************************************

HsCD00514292      AGAAAGGCTGAGGATGAACAGGAAGAGGGGCAGCCTGTGAGGATGGCCACCTTTCCAGGC
NM_001570.3       AGAAAGGCTGAGGATGAACAGGAAGAGGGGCAGCCTGTGAGGATGGCCACCTTTCCAGGC
                  ************************************************************

HsCD00514292      CCAGGGTCCTCTCCAGCCAGAGCCCACCAGCCGGCCTTTCTCCAGCCTCCTGAAGAAGAT
NM_001570.3       CCAGGGTCCTCTCCAGCCAGAGCCCACCAGCCGGCCTTTCTCCAGCCTCCTGAAGAAGAT
                  ************************************************************

HsCD00514292      GCCCCTCATTCCTTGAGAAGCGACCTCCCCACTTCGTCTGATTCAAAGGACTTCAGCACC
NM_001570.3       GCCCCTCATTCCTTGAGAAGCGACCTCCCCACTTCGTCTGATTCAAAGGACTTCAGCACC
                  ************************************************************

HsCD00514292      TCCATTCCTAAGCAGGAAAAACTTTTGAGCTTGGCTGGAGACAGCCTTTTCTGGAGTGAG
NM_001570.3       TCCATTCCTAAGCAGGAAAAACTTTTGAGCTTGGCTGGAGACAGCCTTTTCTGGAGTGAG
                  ************************************************************

HsCD00514292      GCAGACGTGGTCCAGGCAACCGATGACTTCAATCAAAACCGCAAAATCAGCCAGGGGACC
NM_001570.3       GCAGACGTGGTCCAGGCAACCGATGACTTCAATCAAAACCGCAAAATCAGCCAGGGGACC
                  ************************************************************

HsCD00514292      TTTGCTGACGTCTACAGAGGGCACAGGCACGGGAAGCCATTCGTCTTCAAGAAGCTCAGA
NM_001570.3       TTTGCTGACGTCTACAGAGGGCACAGGCACGGGAAGCCATTCGTCTTCAAGAAGCTCAGA
                  ************************************************************

HsCD00514292      GAGACAGCCTGTTCAAGTCCAGGATCAATCGAAAGATTCTTCCAGGCAGAGTTGCAGATT
NM_001570.3       GAGACAGCCTGTTCAAGTCCAGGATCAATCGAAAGATTCTTCCAGGCAGAGTTGCAGATT
                  ************************************************************

HsCD00514292      TGTCTTAGATGCTGCCACCCCAATGTCTTACCTGTGCTGGGCTTCTGTGCTGCAAGACAG
NM_001570.3       TGTCTTAGATGCTGCCACCCCAATGTCTTACCTGTGCTGGGCTTCTGTGCTGCAAGACAG
                  ************************************************************

HsCD00514292      TTTCACAGCTTCATCTACCCCTACATGGCAAATGGTTCCCTACAGGACAGACTGCAGGGT
NM_001570.3       TTTCACAGCTTCATCTACCCCTACATGGCAAATGGTTCCCTACAGGACAGACTGCAGGGT
                  ************************************************************

HsCD00514292      CAGGGTGGCTCGGACCCCCTCCCCTGGCCCCAGCGTGTCAGCATCTGCTCAGGGCTGCTC
NM_001570.3       CAGGGTGGCTCGGACCCCCTCCCCTGGCCCCAGCGTGTCAGCATCTGCTCAGGGCTGCTC
                  ************************************************************

HsCD00514292      TGTGCCGTCGAGTACCTGCATGGTCTGGAGATCATCCACAGCAACGTCAAGAGCTCTAAT
NM_001570.3       TGTGCCGTCGAGTACCTGCATGGTCTGGAGATCATCCACAGCAACGTCAAGAGCTCTAAT
                  ************************************************************

HsCD00514292      GTCTTGCTGGACCAAAATCTCACCCCCAAACTTGCTCACCCAATGGCTCATCTGTGTCCT
NM_001570.3       GTCTTGCTGGACCAAAATCTCACCCCCAAACTTGCTCACCCAATGGCTCATCTGTGTCCT
                  ************************************************************

HsCD00514292      GTCAACAAAAGGTCAAAATACACCATGATGAAGACTCACCTGCTCCGGACGTCAGCCGCG
NM_001570.3       GTCAACAAAAGGTCAAAATACACCATGATGAAGACTCACCTGCTCCGGACGTCAGCCGCG
                  ************************************************************

HsCD00514292      TATCTGCCAGAGGATTTCATCCGGGTGGGGCAGCTGACAAAGCGAGTGGACATCTTCAGC
NM_001570.3       TATCTGCCAGAGGATTTCATCCGGGTGGGGCAGCTGACAAAGCGAGTGGACATCTTCAGC
                  ************************************************************

HsCD00514292      TGTGGAATAGTGTTGGCCGAGGTCCTCACGGGCATCCCTGCAATGGATAACAACCGAAGC
NM_001570.3       TGTGGAATAGTGTTGGCCGAGGTCCTCACGGGCATCCCTGCAATGGATAACAACCGAAGC
                  ************************************************************

HsCD00514292      CCGGTTTACCTGAAGGACTTACTCCTCAGTGATATTCCAAGCAGCACCGCCTCGCTCTGC
NM_001570.3       CCGGTTTACCTGAAGGACTTACTCCTCAGTGATATTCCAAGCAGCACCGCCTCGCTCTGC
                  ************************************************************

HsCD00514292      TCCAGGAAGACGGGCGTGGAGAACGTGATGGCAAAGGAGATCTGCCAGAAGTACCTGGAG
NM_001570.3       TCCAGGAAGACGGGCGTGGAGAACGTGATGGCAAAGGAGATCTGCCAGAAGTACCTGGAG
                  ************************************************************

HsCD00514292      AAGGGCGCAGGGAGGCTTCCGGAGGACTGCGCCGAGGCCCTGGCCACGGCTGCCTGCCTG
NM_001570.3       AAGGGCGCAGGGAGGCTTCCGGAGGACTGCGCCGAGGCCCTGGCCACGGCTGCCTGCCTG
                  ************************************************************

HsCD00514292      TGCCTGCGGAGGCGTAACACCAGCCTGCAGGAGGTGTGTGGCTCTGTGGCTGCTGTGGAA
NM_001570.3       TGCCTGCGGAGGCGTAACACCAGCCTGCAGGAGGTGTGTGGCTCTGTGGCTGCTGTGGAA
                  ************************************************************

HsCD00514292      GAGCGGCTCCGAGGTCGGGAGACGTTGCTCCCTTGGAGTGGGCTTTCTGAGGGTACAGGC
NM_001570.3       GAGCGGCTCCGAGGTCGGGAGACGTTGCTCCCTTGGAGTGGGCTTTCTGAGGGTACAGGC
                  ************************************************************

HsCD00514292      TCTTCTTCCAACACCCCAGAGGAAACAGACGACGTTGACAATTCCAGCCTTGATGCCTCC
NM_001570.3       TCTTCTTCCAACACCCCAGAGGAAACAGACGACGTTGACAATTCCAGCCTTGATGCCTCC
                  ************************************************************

HsCD00514292      TCCTCCATGAGTGTGGCACCCTGGGCAGGGGCTGCCACCCCACTTCTCCCCACAGAGAAT
NM_001570.3       TCCTCCATGAGTGTGGCACCCTGGGCAGGGGCTGCCACCCCACTTCTCCCCACAGAGAAT
                  ************************************************************

HsCD00514292      GGGGAAGGAAGGCTGCGGGTCATCGTGGGAAGGGAGGCTGACTCCTCCTCTGAGGCCTGT
NM_001570.3       GGGGAAGGAAGGCTGCGGGTCATCGTGGGAAGGGAGGCTGACTCCTCCTCTGAGGCCTGT
                  ************************************************************

HsCD00514292      GTTGGCCTGGAGCCTCCCCAGGATGTTACAGAAACTTCGTGGCAAATTGAGATCAATGAG
NM_001570.3       GTTGGCCTGGAGCCTCCCCAGGATGTTACAGAAACTTCGTGGCAAATTGAGATCAATGAG
                  ************************************************************

HsCD00514292      GCCAAAAGGAAACTGATGGAGAATATTCTGCTCTACAAAGAGGAAAAAGTGGACAGCATT
NM_001570.3       GCCAAAAGGAAACTGATGGAGAATATTCTGCTCTACAAAGAGGAAAAAGTGGACAGCATT
                  ************************************************************

HsCD00514292      GAGCTCTTTGGCCCC---
NM_001570.3       GAGCTCTTTGGCCCCTGA
                  ***************   

Pathways

NCI : Endogenous TLR signaling
Reactome : Activated TLR4 signalling
Reactome : Cytokine Signaling in Immune system
Reactome : IRAK2 mediated activation of TAK1 complex
Reactome : IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NOD1/2 Signaling Pathway
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : Signaling by Interleukins
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
WikiPathway : IL-1 signaling pathway
WikiPathway : Regulation of toll-like receptor signaling pathway

Clone

Cloning Information : 665643
Original Clone ID : ccsbBroadEn_00879

Organism


TAX_ID : 9606
Species Specific ID: 3656

Genome

Chromosome : 3
Map Location : 3p25.3
Ensembl : ENSG00000134070

Reagents

Labome : IRAK2-antibody