DNASU Plasmid Repository • 480.965.5697 | Email

BRCA1 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  BRCA1
Gene Name:  breast cancer 1, early onset
Sequence             
Original Clone ID: ccsbBroadEn_00173
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC072418.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00514579

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2098nts         Open reading frame : 1 to 2098
Reference Sequence Alignment

ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAA
ATCTTAGAGTGTCCCATCTGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGAC
CACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAG
TGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGT
CAACTTGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAG
TATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGAT
GAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACAGAGT
GAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGA
ACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATT
GAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGA
GATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCT
GCAAAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAA
CCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAG
TATCAGGGTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCA
GGGCTATCCTCTCAGAGTGACATTTTAACCACTCAGCAGAGGGATACCATGCAACATAAC
CTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAGCATGGGAGC
CAGCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGA
AATCCAGAACAAAGCACATCAGAAAAAGTATTAACTTCACAGAAAAGTAGTGAATACCCT
ATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGTTCT
ACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGTCATCCCCTTCTAAATGCCCATCATTA
GATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCT
CAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCA
CACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAGAGGGAACCCCTTACCTG
GAATCTGGAATCAGCCTCTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACAGAGCC
CCAGAGTCAGCTCGTGTTGGCAACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAA
TTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGG
TATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAA
AGGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGACCCCAGAAGAATTTATGCTC
GTGTACAAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGAGACT
ACTCATGTTGTTATGAAAACAGATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTT
CTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCTGGGTGACCCAGTCTATTAAA
GAAAGAAAAATGCTGAATGAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGA
AACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGATCTTCAGGGGGCTA
GAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAGGGTGTCCACCCAATTGTGGT
TGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCCATGCAATTGGGCAGATGTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : BRCA1
Symbol Nomenclature : BRCA1
SYNONYM : BRCAI; BRCC1; BROVCA1; IRIS; PNCA4; PPP1R53; PSCP; RNF53
Designation : BRCA1/BRCA2-containing complex, subunit 1|RING finger protein 53|breast and ovarian cancer susceptibility protein 1|breast and ovarian cancer sususceptibility protein 1|breast cancer type 1 susceptibility protein|protein phosphatase 1, regulatory subunit 53
Full Nomenclature : breast cancer 1, early onset
GENEID : 672
HGNC : 1100
MIM : 113705
Vega : OTTHUMG00000157426
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00514579      ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAA
NM_007298.3       ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAA
NM_007299.3       ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAA
                  ************************************************************

HsCD00514579      ATCTTAGAGTGTCCCATCTGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGAC
NM_007298.3       ATCTTAGAGTGTCCCATCTGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGAC
NM_007299.3       ATCTTAGAGTGTCCCATCTGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGAC
                  ************************************************************

HsCD00514579      CACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAG
NM_007298.3       CACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAG
NM_007299.3       CACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAG
                  ************************************************************

HsCD00514579      TGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGT
NM_007298.3       TGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGT
NM_007299.3       TGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGT
                  ************************************************************

HsCD00514579      CAACTTGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAG
NM_007298.3       CAACTTGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAG
NM_007299.3       CAACTTGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAG
                  ************************************************************

HsCD00514579      TATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGAT
NM_007298.3       TATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGAT
NM_007299.3       TATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGAT
                  ************************************************************

HsCD00514579      GAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACAGAGT
NM_007298.3       GAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACAGAGT
NM_007299.3       GAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACAGAGT
                  ************************************************************

HsCD00514579      GAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGA
NM_007298.3       GAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGA
NM_007299.3       GAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGA
                  ************************************************************

HsCD00514579      ACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATT
NM_007298.3       ACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATT
NM_007299.3       ACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATT
                  ************************************************************

HsCD00514579      GAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGA
NM_007298.3       GAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGA
NM_007299.3       GAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGA
                  ************************************************************

HsCD00514579      GATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCT
NM_007298.3       GATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCT
NM_007299.3       GATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCT
                  ************************************************************

HsCD00514579      GCAAAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAA
NM_007298.3       GCAAAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAA
NM_007299.3       GCAAAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAA
                  ************************************************************

HsCD00514579      CCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAG
NM_007298.3       CCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAG
NM_007299.3       CCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAG
                  ************************************************************

HsCD00514579      TATCAGGGTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCA
NM_007298.3       TATCAGGGTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCA
NM_007299.3       TATCAGGGTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCA
                  ************************************************************

HsCD00514579      GGGCTATCCTCTCAGAGTGACATTTTAACCACTCAGCAGAGGGATACCATGCAACATAAC
NM_007298.3       GGGCTATCCTCTCAGAGTGACATTTTAACCACTCAGCAGAGGGATACCATGCAACATAAC
NM_007299.3       GGGCTATCCTCTCAGAGTGACATTTTAACCACTCAGCAGAGGGATACCATGCAACATAAC
                  ************************************************************

HsCD00514579      CTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAGCATGGGAGC
NM_007298.3       CTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAGCATGGGAGC
NM_007299.3       CTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAGCATGGGAGC
                  ************************************************************

HsCD00514579      CAGCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGA
NM_007298.3       CAGCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGA
NM_007299.3       CAGCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGA
                  ************************************************************

HsCD00514579      AATCCAGAACAAAGCACATCAGAAAAAGTATTAACTTCACAGAAAAGTAGTGAATACCCT
NM_007298.3       AATCCAGAACAAAGCACATCAGAAAAAGTATTAACTTCACAGAAAAGTAGTGAATACCCT
NM_007299.3       AATCCAGAACAAAGCACATCAGAAAAAGTATTAACTTCACAGAAAAGTAGTGAATACCCT
                  ************************************************************

HsCD00514579      ATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGTTCT
NM_007298.3       ATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGTTCT
NM_007299.3       ATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGTTCT
                  ************************************************************

HsCD00514579      ACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGTCATCCCCTTCTAAATGCCCATCATTA
NM_007298.3       ACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGTCATCCCCTTCTAAATGCCCATCATTA
NM_007299.3       ACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGTCATCCCCTTCTAAATGCCCATCATTA
                  ************************************************************

HsCD00514579      GATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCT
NM_007298.3       GATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCT
NM_007299.3       GATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCT
                  ************************************************************

HsCD00514579      CAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCA
NM_007298.3       CAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCA
NM_007299.3       CAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCA
                  ************************************************************

HsCD00514579      CACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAGAGGGAACCCCTTACCTG
NM_007298.3       CACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAGAGGGAACCCCTTACCTG
NM_007299.3       CACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAGAGGGAACCCCTTACCTG
                  ************************************************************

HsCD00514579      GAATCTGGAATCAGCCTCTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACAGAGCC
NM_007298.3       GAATCTGGAATCAGCCTCTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACAGAGCC
NM_007299.3       GAATCTGGAATCAGCCTCTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACAGAGCC
                  ************************************************************

HsCD00514579      CCAGAGTCAGCTCGTGTTGGCAACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAA
NM_007298.3       CCAGAGTCAGCTCGTGTTGGCAACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAA
NM_007299.3       CCAGAGTCAGCTCGTGTTGGCAACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAA
                  ************************************************************

HsCD00514579      TTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGG
NM_007298.3       TTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGG
NM_007299.3       TTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGG
                  ************************************************************

HsCD00514579      TATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAA
NM_007298.3       TATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAA
NM_007299.3       TATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAA
                  ************************************************************

HsCD00514579      AGGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGACCCCAGAAGAATTTATGCTC
NM_007298.3       AGGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGACCCCAGAAGAATTTATGCTC
NM_007299.3       AGGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGACCCCAGAAGAATTTATGCTC
                  ************************************************************

HsCD00514579      GTGTACAAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGAGACT
NM_007298.3       GTGTACAAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGAGACT
NM_007299.3       GTGTACAAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGAGACT
                  ************************************************************

HsCD00514579      ACTCATGTTGTTATGAAAACAGATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTT
NM_007298.3       ACTCATGTTGTTATGAAAACAGATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTT
NM_007299.3       ACTCATGTTGTTATGAAAACAGATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTT
                  ************************************************************

HsCD00514579      CTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCTGGGTGACCCAGTCTATTAAA
NM_007298.3       CTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCTGGGTGACCCAGTCTATTAAA
NM_007299.3       CTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCTGGGTGACCCAGTCTATTAAA
                  ************************************************************

HsCD00514579      GAAAGAAAAATGCTGAATGAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGA
NM_007298.3       GAAAGAAAAATGCTGAATGAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGA
NM_007299.3       GAAAGAAAAATGCTGAATGAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGA
                  ************************************************************

HsCD00514579      AACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGATCTTCAGGGGGCTA
NM_007298.3       AACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGATCTTCAGGGGGCTA
NM_007299.3       AACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGATCTTCAGGGGGCTA
                  ************************************************************

HsCD00514579      GAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAGG-------------------
NM_007298.3       GAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAGATCAACTGGAATGGATGGTA
NM_007299.3       GAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAGG-------------------
                  ****************************************.                   

HsCD00514579      -------------------------------------------------------GTGTC
NM_007298.3       CAGCTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCACAGGTGTC
NM_007299.3       -------------------------------------------------------GTGTC
                                                                         *****

HsCD00514579      CACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCCATGCAATT
NM_007298.3       CACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCCATGCAATT
NM_007299.3       CACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCCATGCAATT
                  ************************************************************

HsCD00514579      GGGCAGATGTG-------------------------------------------------
NM_007298.3       GGGCAGATGTGTGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTC
NM_007299.3       GGGCAGATGTGTGA----------------------------------------------
                  ***********                                                 

HsCD00514579      ------------------------------------------------------------
NM_007298.3       TACCAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGA
NM_007299.3       ------------------------------------------------------------
                                                                              

Pathways

NCI : ATF-2 transcription factor network
NCI : ATM pathway
NCI : Aurora A signaling
NCI : BARD1 signaling events
NCI : Coregulation of Androgen receptor activity
NCI : E2F transcription factor network
NCI : FOXA1 transcription factor network
NCI : Fanconi anemia pathway
NCI : Validated nuclear estrogen receptor alpha network
NCI : Validated targets of C-MYC transcriptional repression
Reactome : ATM mediated phosphorylation of repair proteins
Reactome : ATM mediated response to DNA double-strand break
Reactome : Cell Cycle
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Fanconi Anemia pathway
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Meiotic synapsis
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
WikiPathway : Androgen receptor signaling pathway
WikiPathway : DNA damage response
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : miRNA regulation of DNA Damage Response

Protein

SMART domain : BRCT : breast cancer carboxy-terminal domain
SMART domain : RING : Ring finger
HPRD : 00218

Clone

Cloning Information : 605723
Original Clone ID : ccsbBroadEn_00173

Organism


TAX_ID : 9606
Species Specific ID: 672

Genome

Chromosome : 17
Map Location : 17q21
Ensembl : ENSG00000012048

Reagents

Labome : BRCA1-antibody