DNASU Plasmid Repository • 480.965.5697 | Email

NFKB1 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NFKB1
Gene Name:  nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
Sequence             
Original Clone ID: ccsbBroadEn_06637
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC051765.1
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00514661

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2908nts         Open reading frame : 1 to 2908
Reference Sequence Alignment

ATGGCAGAAGATGATCCATATTTGGGAAGGCCTGAACAAATGTTTCATTTGGATCCTTCT
TTGACTCATACAATATTTAATCCAGAAGTATTTCAACCACAGATGGCACTGCCAACAGCA
GATGGCCCATACCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTAT
GTATGTGAAGGCCCATCCCATGGTGGACTACCTGGTGCCTCTAGTGAAAAGAACAAGAAG
TCTTACCCTCAGGTCAAAATCTGCAACTATGTGGGACCAGCAAAGGTTATTGTTCAGTTG
GTCACAAATGGAAAAAATATCCACCTGCATGCCCACAGCCTGGTGGGAAAACACTGTGAG
GATGGGATCTGCACTGTAACTGCTGGACCCAAGGACATGGTGGTCGGCTTCGCAAACCTG
GGTATACTTCATGTGACAAAGAAAAAAGTATTTGAAACACTGGAAGCACGAATGACAGAG
GCGTGTATAAGGGGCTATAATCCTGGACTCTTGGTGCACCCTGACCTTGCCTATTTGCAA
GCAGAAGGTGGAGGGGACCGGCAGCTGGGAGATCGGGAAAAAGAGCTAATCCGCCAAGCA
GCTCTGCAGCAGACCAAGGAGATGGACCTCAGCGTGGTGCGGCTCATGTTTACAGCTTTT
CTTCCGGATAGCACTGGCAGCTTCACAAGGCGCCTGGAACCCGTGGTATCAGACGCCATC
TATGACAGTAAAGCCCCCAATGCATCCAACTTGAAAATTGTAAGAATGGACAGGACAGCT
GGATGTGTGACTGGAGGGGAGGAAATTTATCTTCTTTGTGACAAAGTTCAGAAAGATGAC
ATCCAGATTCGATTTTATGAAGAGGAAGAAAATGGTGGAGTCTGGGAAGGATTTGGAGAT
TTTTCCCCCACAGATGTTCATAGACAATTTGCCATTGTCTTCAAAACTCCAAAGTATAAA
GATATTAATATTACAAAACCAGCCTCTGTGTTTGTCCAGCTTCGGAGGAAATCTGACTTG
GAAACTAGTGAACCAAAACCTTTCCTCTACTATCCTGAAATCAAAGATAAAGAAGAAGTG
CAGAGGAAACGTCAGAAGCTCATGCCCAATTTTTCGGATAGTTTCGGCGGTGGTAGTGGT
GCCGGAGCTGGAGGCGGAGGCATGTTTGGTAGTGGCGGTGGAGGAGGGGGCACTGGAAGT
ACAGGTCCAGGGTATAGCTTCCCACACTATGGATTTCCTACTTATGGTGGGATTACTTTC
CATCCTGGAACTACTAAATCTAATGCTGGGATGAAGCATGGAACCATGGACACTGAATCT
AAAAAGGACCCTGAAGGTTGTGACAAAAGTGATGACAAAAACACTGTAAACCTCTTTGGG
AAAGTTATTGAAACCACAGAGCAAGATCAGGAGCCCAGCGAGGCCACCGTTGGGAATGGT
GAGGTCACTCTAACGTATGCAACAGGAACAAAAGAAGAGAGTGCTGGAGTTCAGGATAAC
CTCTTTCTAGAGAAGGCTATGCAGCTTGCAAAGAGGCATGCCAATGCCCTTTTCGACTAC
GCGGTGACAGGAGACGTGAAGATGCTGCTGGCCGTCCAGCGCCATCTCACTGCTGTGCAG
GATGAGAATGGGGACAGTGTCTTACACTTAGCAATCATCCACCTTCATTCTCAACTTGTG
AGGGATCTACTAGAAGTCACATCTGGTTTGATTTCTGATGACATTATCAACATGAGAAAT
GATCTGTACCAGACGCCCTTGCACTTGGCAGTGATCACTAAGCAGGAAGATGTGGTGGAG
GATTTGCTGAGGGCTGGGGCCGACCTGAGCCTTCTGGACCGCTTGGGTAACTCTGTTTTG
CACCTAGCTGCCAAAGAAGGACATGATAAAGTTCTCAGTATCTTACTCAAGCACAAAAAG
GCAGCACTACTTCTTGACCACCCCAACGGGGACGGTCTGAATGCCATTCATCTAGCCATG
ATGAGCAATAGCCTGCCATGTTTGCTGCTGCTGGTGGCCGCTGGGGCTGACGTCAATGCT
CAGGAGCAGAAGTCCGGGCGCACAGCACTGCACCTGGCTGTGGAGCACGACAACATCTCA
TTGGCAGGCTGCCTGCTCCTGGAAGGTGATGCCCATGTGGACAGTACTACCTACGATGGA
ACCACACCCCTGCATATAGCAGCTGGGAGAGGGTCCACCAGGCTGGCAGCTCTTCTCAAA
GCAGCAGGAGCAGATCCCCTGGTGGAGAACTTTGAGCCTCTCTATGACCTGGATGACTCT
TGGGAAAATGCAGGAGAGGATGAAGGAGTTGTGCCTGGAACCACGCCTCTAGATATGGCC
ACCAGCTGGCAGGTATTTGACATATTAAATGGGAAACCATATGAGCCAGAGTTTACATCT
GATGATTTACTAGCACAAGGAGACATGAAACAGCTGGCTGAAGATGTGAAGCTGCAGCTG
TATAAGTTACTAGAAATTCCTGATCCAGACAAAAACTGGGCTACTCTGGCGCAGAAATTA
GGTCTGGGGATACTTAATAATGCCTTCCGGCTGAGTCCTGCTCCTTCCAAAACACTTATG
GACAACTATGAGGTCTCTGGGGGTACAGTCAGAGAGCTGGTGGAGGCCCTGAGACAAATG
GGCTACACCGAAGCAATTGAAGTGATCCAGGCAGCCTCCAGCCCAGTGAAGACCACCTCT
CAGGCCCACTCGCTGCCTCTCTCGCCTGCCTCCACAAGGCAGCAAATAGACGAGCTCCGA
GACAGTGACAGTGTCTGCGACAGCGGCGTGGAGACATCCTTCCGCAAACTCAGCTTTACC
GAGTCTCTGACCAGTGGTGCCTCACTGCTAACTCTCAACAAAATGCCCCATGATTATGGG
CAGGAAGGACCTCTAGAAGGCAAAATT


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
1 error
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NFKB1
Symbol Nomenclature : NFKB1
SYNONYM : EBP-1; KBF1; NF-kB1; NF-kappa-B; NF-kappaB; NFKB-p105; NFKB-p50; NFkappaB; p105; p50
Designation : DNA binding factor KBF1|DNA-binding factor KBF1|NF-kappabeta|nuclear factor NF-kappa-B p105 subunit|nuclear factor NF-kappa-B p50 subunit|nuclear factor kappa-B DNA binding subunit
Full Nomenclature : nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
GENEID : 4790
GenBank Accession : EU446640
HGNC : 7794
MIM : 164011
Vega : OTTHUMG00000161080
Target GenBank: EU446640

 

Reference Sequence Alignment

  

HsCD00514661        ------------------------ATGGCAGAAGATGATCCATATTTGGGAAGGCCTGAA
NM_001165412.1      ------------------------ATGGCAGAAGATGATCCATATTTGGGAAGGCCTGAA
NM_003998.3         ------------------------ATGGCAGAAGATGATCCATATTTGGGAAGGCCTGAA
XM_005263029.1      ATGAAAAGAACCACCAGCTTCAGAATGGCAGAAGATGATCCATATTTGGGAAGGCCTGAA
                                            ************************************

HsCD00514661        CAAATGTTTCATTTGGATCCTTCTTTGACTCATACAATATTTAATCCAGAAGTATTTCAA
NM_001165412.1      CAAATGTTTCATTTGGATCCTTCTTTGACTCATACAATATTTAATCCAGAAGTATTTCAA
NM_003998.3         CAAATGTTTCATTTGGATCCTTCTTTGACTCATACAATATTTAATCCAGAAGTATTTCAA
XM_005263029.1      CAAATGTTTCATTTGGATCCTTCTTTGACTCATACAATATTTAATCCAGAAGTATTTCAA
                    ************************************************************

HsCD00514661        CCACAGATGGCACTGCCAACAGCAGATGGCCCATACCTTCAAATATTAGAGCAACCTAAA
NM_001165412.1      CCACAGATGGCACTGCCAACAGAT---GGCCCATACCTTCAAATATTAGAGCAACCTAAA
NM_003998.3         CCACAGATGGCACTGCCAACAGCAGATGGCCCATACCTTCAAATATTAGAGCAACCTAAA
XM_005263029.1      CCACAGATGGCACTGCCAACAGCAGATGGCCCATACCTTCAAATATTAGAGCAACCTAAA
                    **********************.:   *********************************

HsCD00514661        CAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTACCTGGT
NM_001165412.1      CAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTACCTGGT
NM_003998.3         CAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTACCTGGT
XM_005263029.1      CAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTACCTGGT
                    ************************************************************

HsCD00514661        GCCTCTAGTGAAAAGAACAAGAAGTCTTACCCTCAGGTCAAAATCTGCAACTATGTGGGA
NM_001165412.1      GCCTCTAGTGAAAAGAACAAGAAGTCTTACCCTCAGGTCAAAATCTGCAACTATGTGGGA
NM_003998.3         GCCTCTAGTGAAAAGAACAAGAAGTCTTACCCTCAGGTCAAAATCTGCAACTATGTGGGA
XM_005263029.1      GCCTCTAGTGAAAAGAACAAGAAGTCTTACCCTCAGGTCAAAATCTGCAACTATGTGGGA
                    ************************************************************

HsCD00514661        CCAGCAAAGGTTATTGTTCAGTTGGTCACAAATGGAAAAAATATCCACCTGCATGCCCAC
NM_001165412.1      CCAGCAAAGGTTATTGTTCAGTTGGTCACAAATGGAAAAAATATCCACCTGCATGCCCAC
NM_003998.3         CCAGCAAAGGTTATTGTTCAGTTGGTCACAAATGGAAAAAATATCCACCTGCATGCCCAC
XM_005263029.1      CCAGCAAAGGTTATTGTTCAGTTGGTCACAAATGGAAAAAATATCCACCTGCATGCCCAC
                    ************************************************************

HsCD00514661        AGCCTGGTGGGAAAACACTGTGAGGATGGGATCTGCACTGTAACTGCTGGACCCAAGGAC
NM_001165412.1      AGCCTGGTGGGAAAACACTGTGAGGATGGGATCTGCACTGTAACTGCTGGACCCAAGGAC
NM_003998.3         AGCCTGGTGGGAAAACACTGTGAGGATGGGATCTGCACTGTAACTGCTGGACCCAAGGAC
XM_005263029.1      AGCCTGGTGGGAAAACACTGTGAGGATGGGATCTGCACTGTAACTGCTGGACCCAAGGAC
                    ************************************************************

HsCD00514661        ATGGTGGTCGGCTTCGCAAACCTGGGTATACTTCATGTGACAAAGAAAAAAGTATTTGAA
NM_001165412.1      ATGGTGGTCGGCTTCGCAAACCTGGGTATACTTCATGTGACAAAGAAAAAAGTATTTGAA
NM_003998.3         ATGGTGGTCGGCTTCGCAAACCTGGGTATACTTCATGTGACAAAGAAAAAAGTATTTGAA
XM_005263029.1      ATGGTGGTCGGCTTCGCAAACCTGGGTATACTTCATGTGACAAAGAAAAAAGTATTTGAA
                    ************************************************************

HsCD00514661        ACACTGGAAGCACGAATGACAGAGGCGTGTATAAGGGGCTATAATCCTGGACTCTTGGTG
NM_001165412.1      ACACTGGAAGCACGAATGACAGAGGCGTGTATAAGGGGCTATAATCCTGGACTCTTGGTG
NM_003998.3         ACACTGGAAGCACGAATGACAGAGGCGTGTATAAGGGGCTATAATCCTGGACTCTTGGTG
XM_005263029.1      ACACTGGAAGCACGAATGACAGAGGCGTGTATAAGGGGCTATAATCCTGGACTCTTGGTG
                    ************************************************************

HsCD00514661        CACCCTGACCTTGCCTATTTGCAAGCAGAAGGTGGAGGGGACCGGCAGCTGGGAGATCGG
NM_001165412.1      CACCCTGACCTTGCCTATTTGCAAGCAGAAGGTGGAGGGGACCGGCAGCTGGGAGATCGG
NM_003998.3         CACCCTGACCTTGCCTATTTGCAAGCAGAAGGTGGAGGGGACCGGCAGCTGGGAGATCGG
XM_005263029.1      CACCCTGACCTTGCCTATTTGCAAGCAGAAGGTGGAGGGGACCGGCAGCTGGGAGATCGG
                    ************************************************************

HsCD00514661        GAAAAAGAGCTAATCCGCCAAGCAGCTCTGCAGCAGACCAAGGAGATGGACCTCAGCGTG
NM_001165412.1      GAAAAAGAGCTAATCCGCCAAGCAGCTCTGCAGCAGACCAAGGAGATGGACCTCAGCGTG
NM_003998.3         GAAAAAGAGCTAATCCGCCAAGCAGCTCTGCAGCAGACCAAGGAGATGGACCTCAGCGTG
XM_005263029.1      GAAAAAGAGCTAATCCGCCAAGCAGCTCTGCAGCAGACCAAGGAGATGGACCTCAGCGTG
                    ************************************************************

HsCD00514661        GTGCGGCTCATGTTTACAGCTTTTCTTCCGGATAGCACTGGCAGCTTCACAAGGCGCCTG
NM_001165412.1      GTGCGGCTCATGTTTACAGCTTTTCTTCCGGATAGCACTGGCAGCTTCACAAGGCGCCTG
NM_003998.3         GTGCGGCTCATGTTTACAGCTTTTCTTCCGGATAGCACTGGCAGCTTCACAAGGCGCCTG
XM_005263029.1      GTGCGGCTCATGTTTACAGCTTTTCTTCCGGATAGCACTGGCAGCTTCACAAGGCGCCTG
                    ************************************************************

HsCD00514661        GAACCCGTGGTATCAGACGCCATCTATGACAGTAAAGCCCCCAATGCATCCAACTTGAAA
NM_001165412.1      GAACCCGTGGTATCAGACGCCATCTATGACAGTAAAGCCCCCAATGCATCCAACTTGAAA
NM_003998.3         GAACCCGTGGTATCAGACGCCATCTATGACAGTAAAGCCCCCAATGCATCCAACTTGAAA
XM_005263029.1      GAACCCGTGGTATCAGACGCCATCTATGACAGTAAAGCCCCCAATGCATCCAACTTGAAA
                    ************************************************************

HsCD00514661        ATTGTAAGAATGGACAGGACAGCTGGATGTGTGACTGGAGGGGAGGAAATTTATCTTCTT
NM_001165412.1      ATTGTAAGAATGGACAGGACAGCTGGATGTGTGACTGGAGGGGAGGAAATTTATCTTCTT
NM_003998.3         ATTGTAAGAATGGACAGGACAGCTGGATGTGTGACTGGAGGGGAGGAAATTTATCTTCTT
XM_005263029.1      ATTGTAAGAATGGACAGGACAGCTGGATGTGTGACTGGAGGGGAGGAAATTTATCTTCTT
                    ************************************************************

HsCD00514661        TGTGACAAAGTTCAGAAAGATGACATCCAGATTCGATTTTATGAAGAGGAAGAAAATGGT
NM_001165412.1      TGTGACAAAGTTCAGAAAGATGACATCCAGATTCGATTTTATGAAGAGGAAGAAAATGGT
NM_003998.3         TGTGACAAAGTTCAGAAAGATGACATCCAGATTCGATTTTATGAAGAGGAAGAAAATGGT
XM_005263029.1      TGTGACAAAGTTCAGAAAGATGACATCCAGATTCGATTTTATGAAGAGGAAGAAAATGGT
                    ************************************************************

HsCD00514661        GGAGTCTGGGAAGGATTTGGAGATTTTTCCCCCACAGATGTTCATAGACAATTTGCCATT
NM_001165412.1      GGAGTCTGGGAAGGATTTGGAGATTTTTCCCCCACAGATGTTCATAGACAATTTGCCATT
NM_003998.3         GGAGTCTGGGAAGGATTTGGAGATTTTTCCCCCACAGATGTTCATAGACAATTTGCCATT
XM_005263029.1      GGAGTCTGGGAAGGATTTGGAGATTTTTCCCCCACAGATGTTCATAGACAATTTGCCATT
                    ************************************************************

HsCD00514661        GTCTTCAAAACTCCAAAGTATAAAGATATTAATATTACAAAACCAGCCTCTGTGTTTGTC
NM_001165412.1      GTCTTCAAAACTCCAAAGTATAAAGATATTAATATTACAAAACCAGCCTCTGTGTTTGTC
NM_003998.3         GTCTTCAAAACTCCAAAGTATAAAGATATTAATATTACAAAACCAGCCTCTGTGTTTGTC
XM_005263029.1      GTCTTCAAAACTCCAAAGTATAAAGATATTAATATTACAAAACCAGCCTCTGTGTTTGTC
                    ************************************************************

HsCD00514661        CAGCTTCGGAGGAAATCTGACTTGGAAACTAGTGAACCAAAACCTTTCCTCTACTATCCT
NM_001165412.1      CAGCTTCGGAGGAAATCTGACTTGGAAACTAGTGAACCAAAACCTTTCCTCTACTATCCT
NM_003998.3         CAGCTTCGGAGGAAATCTGACTTGGAAACTAGTGAACCAAAACCTTTCCTCTACTATCCT
XM_005263029.1      CAGCTTCGGAGGAAATCTGACTTGGAAACTAGTGAACCAAAACCTTTCCTCTACTATCCT
                    ************************************************************

HsCD00514661        GAAATCAAAGATAAAGAAGAAGTGCAGAGGAAACGTCAGAAGCTCATGCCCAATTTTTCG
NM_001165412.1      GAAATCAAAGATAAAGAAGAAGTGCAGAGGAAACGTCAGAAGCTCATGCCCAATTTTTCG
NM_003998.3         GAAATCAAAGATAAAGAAGAAGTGCAGAGGAAACGTCAGAAGCTCATGCCCAATTTTTCG
XM_005263029.1      GAAATCAAAGATAAAGAAGAAGTGCAGAGGAAACGTCAGAAGCTCATGCCCAATTTTTCG
                    ************************************************************

HsCD00514661        GATAGTTTCGGCGGTGGTAGTGGTGCCGGAGCTGGAGGCGGAGGCATGTTTGGTAGTGGC
NM_001165412.1      GATAGTTTCGGCGGTGGTAGTGGTGCTGGAGCTGGAGGCGGAGGCATGTTTGGTAGTGGC
NM_003998.3         GATAGTTTCGGCGGTGGTAGTGGTGCTGGAGCTGGAGGCGGAGGCATGTTTGGTAGTGGC
XM_005263029.1      GATAGTTTCGGCGGTGGTAGTGGTGCTGGAGCTGGAGGCGGAGGCATGTTTGGTAGTGGC
                    ************************** *********************************

HsCD00514661        GGTGGAGGAGGGGGCACTGGAAGTACAGGTCCAGGGTATAGCTTCCCACACTATGGATTT
NM_001165412.1      GGTGGAGGAGGGGGCACTGGAAGTACAGGTCCAGGGTATAGCTTCCCACACTATGGATTT
NM_003998.3         GGTGGAGGAGGGGGCACTGGAAGTACAGGTCCAGGGTATAGCTTCCCACACTATGGATTT
XM_005263029.1      GGTGGAGGAGGGGGCACTGGAAGTACAGGTCCAGGGTATAGCTTCCCACACTATGGATTT
                    ************************************************************

HsCD00514661        CCTACTTATGGTGGGATTACTTTCCATCCTGGAACTACTAAATCTAATGCTGGGATGAAG
NM_001165412.1      CCTACTTATGGTGGGATTACTTTCCATCCTGGAACTACTAAATCTAATGCTGGGATGAAG
NM_003998.3         CCTACTTATGGTGGGATTACTTTCCATCCTGGAACTACTAAATCTAATGCTGGGATGAAG
XM_005263029.1      CCTACTTATGGTGGGATTACTTTCCATCCTGGAACTACTAAATCTAATGCTGGGATGAAG
                    ************************************************************

HsCD00514661        CATGGAACCATGGACACTGAATCTAAAAAGGACCCTGAAGGTTGTGACAAAAGTGATGAC
NM_001165412.1      CATGGAACCATGGACACTGAATCTAAAAAGGACCCTGAAGGTTGTGACAAAAGTGATGAC
NM_003998.3         CATGGAACCATGGACACTGAATCTAAAAAGGACCCTGAAGGTTGTGACAAAAGTGATGAC
XM_005263029.1      CATGGAACCATGGACACTGAATCTAAAAAGGACCCTGAAGGTTGTGACAAAAGTGATGAC
                    ************************************************************

HsCD00514661        AAAAACACTGTAAACCTCTTTGGGAAAGTTATTGAAACCACAGAGCAAGATCAGGAGCCC
NM_001165412.1      AAAAACACTGTAAACCTCTTTGGGAAAGTTATTGAAACCACAGAGCAAGATCAGGAGCCC
NM_003998.3         AAAAACACTGTAAACCTCTTTGGGAAAGTTATTGAAACCACAGAGCAAGATCAGGAGCCC
XM_005263029.1      AAAAACACTGTAAACCTCTTTGGGAAAGTTATTGAAACCACAGAGCAAGATCAGGAGCCC
                    ************************************************************

HsCD00514661        AGCGAGGCCACCGTTGGGAATGGTGAGGTCACTCTAACGTATGCAACAGGAACAAAAGAA
NM_001165412.1      AGCGAGGCCACCGTTGGGAATGGTGAGGTCACTCTAACGTATGCAACAGGAACAAAAGAA
NM_003998.3         AGCGAGGCCACCGTTGGGAATGGTGAGGTCACTCTAACGTATGCAACAGGAACAAAAGAA
XM_005263029.1      AGCGAGGCCACCGTTGGGAATGGTGAGGTCACTCTAACGTATGCAACAGGAACAAAAGAA
                    ************************************************************

HsCD00514661        GAGAGTGCTGGAGTTCAGGATAACCTCTTTCTAGAGAAGGCTATGCAGCTTGCAAAGAGG
NM_001165412.1      GAGAGTGCTGGAGTTCAGGATAACCTCTTTCTAGAGAAGGCTATGCAGCTTGCAAAGAGG
NM_003998.3         GAGAGTGCTGGAGTTCAGGATAACCTCTTTCTAGAGAAGGCTATGCAGCTTGCAAAGAGG
XM_005263029.1      GAGAGTGCTGGAGTTCAGGATAACCTCTTTCTAGAGAAGGCTATGCAGCTTGCAAAGAGG
                    ************************************************************

HsCD00514661        CATGCCAATGCCCTTTTCGACTACGCGGTGACAGGAGACGTGAAGATGCTGCTGGCCGTC
NM_001165412.1      CATGCCAATGCCCTTTTCGACTACGCGGTGACAGGAGACGTGAAGATGCTGCTGGCCGTC
NM_003998.3         CATGCCAATGCCCTTTTCGACTACGCGGTGACAGGAGACGTGAAGATGCTGCTGGCCGTC
XM_005263029.1      CATGCCAATGCCCTTTTCGACTACGCGGTGACAGGAGACGTGAAGATGCTGCTGGCCGTC
                    ************************************************************

HsCD00514661        CAGCGCCATCTCACTGCTGTGCAGGATGAGAATGGGGACAGTGTCTTACACTTAGCAATC
NM_001165412.1      CAGCGCCATCTCACTGCTGTGCAGGATGAGAATGGGGACAGTGTCTTACACTTAGCAATC
NM_003998.3         CAGCGCCATCTCACTGCTGTGCAGGATGAGAATGGGGACAGTGTCTTACACTTAGCAATC
XM_005263029.1      CAGCGCCATCTCACTGCTGTGCAGGATGAGAATGGGGACAGTGTCTTACACTTAGCAATC
                    ************************************************************

HsCD00514661        ATCCACCTTCATTCTCAACTTGTGAGGGATCTACTAGAAGTCACATCTGGTTTGATTTCT
NM_001165412.1      ATCCACCTTCATTCTCAACTTGTGAGGGATCTACTAGAAGTCACATCTGGTTTGATTTCT
NM_003998.3         ATCCACCTTCATTCTCAACTTGTGAGGGATCTACTAGAAGTCACATCTGGTTTGATTTCT
XM_005263029.1      ATCCACCTTCATTCTCAACTTGTGAGGGATCTACTAGAAGTCACATCTGGTTTGATTTCT
                    ************************************************************

HsCD00514661        GATGACATTATCAACATGAGAAATGATCTGTACCAGACGCCCTTGCACTTGGCAGTGATC
NM_001165412.1      GATGACATTATCAACATGAGAAATGATCTGTACCAGACGCCCTTGCACTTGGCAGTGATC
NM_003998.3         GATGACATTATCAACATGAGAAATGATCTGTACCAGACGCCCTTGCACTTGGCAGTGATC
XM_005263029.1      GATGACATTATCAACATGAGAAATGATCTGTACCAGACGCCCTTGCACTTGGCAGTGATC
                    ************************************************************

HsCD00514661        ACTAAGCAGGAAGATGTGGTGGAGGATTTGCTGAGGGCTGGGGCCGACCTGAGCCTTCTG
NM_001165412.1      ACTAAGCAGGAAGATGTGGTGGAGGATTTGCTGAGGGCTGGGGCCGACCTGAGCCTTCTG
NM_003998.3         ACTAAGCAGGAAGATGTGGTGGAGGATTTGCTGAGGGCTGGGGCCGACCTGAGCCTTCTG
XM_005263029.1      ACTAAGCAGGAAGATGTGGTGGAGGATTTGCTGAGGGCTGGGGCCGACCTGAGCCTTCTG
                    ************************************************************

HsCD00514661        GACCGCTTGGGTAACTCTGTTTTGCACCTAGCTGCCAAAGAAGGACATGATAAAGTTCTC
NM_001165412.1      GACCGCTTGGGTAACTCTGTTTTGCACCTAGCTGCCAAAGAAGGACATGATAAAGTTCTC
NM_003998.3         GACCGCTTGGGTAACTCTGTTTTGCACCTAGCTGCCAAAGAAGGACATGATAAAGTTCTC
XM_005263029.1      GACCGCTTGGGTAACTCTGTTTTGCACCTAGCTGCCAAAGAAGGACATGATAAAGTTCTC
                    ************************************************************

HsCD00514661        AGTATCTTACTCAAGCACAAAAAGGCAGCACTACTTCTTGACCACCCCAACGGGGACGGT
NM_001165412.1      AGTATCTTACTCAAGCACAAAAAGGCAGCACTACTTCTTGACCACCCCAACGGGGACGGT
NM_003998.3         AGTATCTTACTCAAGCACAAAAAGGCAGCACTACTTCTTGACCACCCCAACGGGGACGGT
XM_005263029.1      AGTATCTTACTCAAGCACAAAAAGGCAGCACTACTTCTTGACCACCCCAACGGGGACGGT
                    ************************************************************

HsCD00514661        CTGAATGCCATTCATCTAGCCATGATGAGCAATAGCCTGCCATGTTTGCTGCTGCTGGTG
NM_001165412.1      CTGAATGCCATTCATCTAGCCATGATGAGCAATAGCCTGCCATGTTTGCTGCTGCTGGTG
NM_003998.3         CTGAATGCCATTCATCTAGCCATGATGAGCAATAGCCTGCCATGTTTGCTGCTGCTGGTG
XM_005263029.1      CTGAATGCCATTCATCTAGCCATGATGAGCAATAGCCTGCCATGTTTGCTGCTGCTGGTG
                    ************************************************************

HsCD00514661        GCCGCTGGGGCTGACGTCAATGCTCAGGAGCAGAAGTCCGGGCGCACAGCACTGCACCTG
NM_001165412.1      GCCGCTGGGGCTGACGTCAATGCTCAGGAGCAGAAGTCCGGGCGCACAGCACTGCACCTG
NM_003998.3         GCCGCTGGGGCTGACGTCAATGCTCAGGAGCAGAAGTCCGGGCGCACAGCACTGCACCTG
XM_005263029.1      GCCGCTGGGGCTGACGTCAATGCTCAGGAGCAGAAGTCCGGGCGCACAGCACTGCACCTG
                    ************************************************************

HsCD00514661        GCTGTGGAGCACGACAACATCTCATTGGCAGGCTGCCTGCTCCTGGAAGGTGATGCCCAT
NM_001165412.1      GCTGTGGAGCACGACAACATCTCATTGGCAGGCTGCCTGCTCCTGGAGGGTGATGCCCAT
NM_003998.3         GCTGTGGAGCACGACAACATCTCATTGGCAGGCTGCCTGCTCCTGGAGGGTGATGCCCAT
XM_005263029.1      GCTGTGGAGCACGACAACATCTCATTGGCAGGCTGCCTGCTCCTGGAGGGTGATGCCCAT
                    ***********************************************.************

HsCD00514661        GTGGACAGTACTACCTACGATGGAACCACACCCCTGCATATAGCAGCTGGGAGAGGGTCC
NM_001165412.1      GTGGACAGTACTACCTACGATGGAACCACACCCCTGCATATAGCAGCTGGGAGAGGGTCC
NM_003998.3         GTGGACAGTACTACCTACGATGGAACCACACCCCTGCATATAGCAGCTGGGAGAGGGTCC
XM_005263029.1      GTGGACAGTACTACCTACGATGGAACCACACCCCTGCATATAGCAGCTGGGAGAGGGTCC
                    ************************************************************

HsCD00514661        ACCAGGCTGGCAGCTCTTCTCAAAGCAGCAGGAGCAGATCCCCTGGTGGAGAACTTTGAG
NM_001165412.1      ACCAGGCTGGCAGCTCTTCTCAAAGCAGCAGGAGCAGATCCCCTGGTGGAGAACTTTGAG
NM_003998.3         ACCAGGCTGGCAGCTCTTCTCAAAGCAGCAGGAGCAGATCCCCTGGTGGAGAACTTTGAG
XM_005263029.1      ACCAGGCTGGCAGCTCTTCTCAAAGCAGCAGGAGCAGATCCCCTGGTGGAGAACTTTGAG
                    ************************************************************

HsCD00514661        CCTCTCTATGACCTGGATGACTCTTGGGAAAATGCAGGAGAGGATGAAGGAGTTGTGCCT
NM_001165412.1      CCTCTCTATGACCTGGATGACTCTTGGGAAAATGCAGGAGAGGATGAAGGAGTTGTGCCT
NM_003998.3         CCTCTCTATGACCTGGATGACTCTTGGGAAAATGCAGGAGAGGATGAAGGAGTTGTGCCT
XM_005263029.1      CCTCTCTATGACCTGGATGACTCTTGGGAAAATGCAGGAGAGGATGAAGGAGTTGTGCCT
                    ************************************************************

HsCD00514661        GGAACCACGCCTCTAGATATGGCCACCAGCTGGCAGGTATTTGACATATTAAATGGGAAA
NM_001165412.1      GGAACCACGCCTCTAGATATGGCCACCAGCTGGCAGGTATTTGACATATTAAATGGGAAA
NM_003998.3         GGAACCACGCCTCTAGATATGGCCACCAGCTGGCAGGTATTTGACATATTAAATGGGAAA
XM_005263029.1      GGAACCACGCCTCTAGATATGGCCACCAGCTGGCAGGTATTTGACATATTAAATGGGAAA
                    ************************************************************

HsCD00514661        CCATATGAGCCAGAGTTTACATCTGATGATTTACTAGCACAAGGAGACATGAAACAGCTG
NM_001165412.1      CCATATGAGCCAGAGTTTACATCTGATGATTTACTAGCACAAGGAGACATGAAACAGCTG
NM_003998.3         CCATATGAGCCAGAGTTTACATCTGATGATTTACTAGCACAAGGAGACATGAAACAGCTG
XM_005263029.1      CCATATGAGCCAGAGTTTACATCTGATGATTTACTAGCACAAGGAGACATGAAACAGCTG
                    ************************************************************

HsCD00514661        GCTGAAGATGTGAAGCTGCAGCTGTATAAGTTACTAGAAATTCCTGATCCAGACAAAAAC
NM_001165412.1      GCTGAAGATGTGAAGCTGCAGCTGTATAAGTTACTAGAAATTCCTGATCCAGACAAAAAC
NM_003998.3         GCTGAAGATGTGAAGCTGCAGCTGTATAAGTTACTAGAAATTCCTGATCCAGACAAAAAC
XM_005263029.1      GCTGAAGATGTGAAGCTGCAGCTGTATAAGTTACTAGAAATTCCTGATCCAGACAAAAAC
                    ************************************************************

HsCD00514661        TGGGCTACTCTGGCGCAGAAATTAGGTCTGGGGATACTTAATAATGCCTTCCGGCTGAGT
NM_001165412.1      TGGGCTACTCTGGCGCAGAAATTAGGTCTGGGGATACTTAATAATGCCTTCCGGCTGAGT
NM_003998.3         TGGGCTACTCTGGCGCAGAAATTAGGTCTGGGGATACTTAATAATGCCTTCCGGCTGAGT
XM_005263029.1      TGGGCTACTCTGGCGCAGAAATTAGGTCTGGGGATACTTAATAATGCCTTCCGGCTGAGT
                    ************************************************************

HsCD00514661        CCTGCTCCTTCCAAAACACTTATGGACAACTATGAGGTCTCTGGGGGTACAGTCAGAGAG
NM_001165412.1      CCTGCTCCTTCCAAAACACTTATGGACAACTATGAGGTCTCTGGGGGTACAGTCAGAGAG
NM_003998.3         CCTGCTCCTTCCAAAACACTTATGGACAACTATGAGGTCTCTGGGGGTACAGTCAGAGAG
XM_005263029.1      CCTGCTCCTTCCAAAACACTTATGGACAACTATGAGGTCTCTGGGGGTACAGTCAGAGAG
                    ************************************************************

HsCD00514661        CTGGTGGAGGCCCTGAGACAAATGGGCTACACCGAAGCAATTGAAGTGATCCAGGCAGCC
NM_001165412.1      CTGGTGGAGGCCCTGAGACAAATGGGCTACACCGAAGCAATTGAAGTGATCCAGGCAGCC
NM_003998.3         CTGGTGGAGGCCCTGAGACAAATGGGCTACACCGAAGCAATTGAAGTGATCCAGGCAGCC
XM_005263029.1      CTGGTGGAGGCCCTGAGACAAATGGGCTACACCGAAGCAATTGAAGTGATCCAGGCAGCC
                    ************************************************************

HsCD00514661        TCCAGCCCAGTGAAGACCACCTCTCAGGCCCACTCGCTGCCTCTCTCGCCTGCCTCCACA
NM_001165412.1      TCCAGCCCAGTGAAGACCACCTCTCAGGCCCACTCGCTGCCTCTCTCGCCTGCCTCCACA
NM_003998.3         TCCAGCCCAGTGAAGACCACCTCTCAGGCCCACTCGCTGCCTCTCTCGCCTGCCTCCACA
XM_005263029.1      TCCAGCCCAGTGAAGACCACCTCTCAGGCCCACTCGCTGCCTCTCTCGCCTGCCTCCACA
                    ************************************************************

HsCD00514661        AGGCAGCAAATAGACGAGCTCCGAGACAGTGACAGTGTCTGCGACAGCGGCGTGGAGACA
NM_001165412.1      AGGCAGCAAATAGACGAGCTCCGAGACAGTGACAGTGTCTGCGACAGCGGCGTGGAGACA
NM_003998.3         AGGCAGCAAATAGACGAGCTCCGAGACAGTGACAGTGTCTGCGACAGCGGCGTGGAGACA
XM_005263029.1      AGGCAGCAAATAGACGAGCTCCGAGACAGTGACAGTGTCTGCGACAGCGGCGTGGAGACA
                    ************************************************************

HsCD00514661        TCCTTCCGCAAACTCAGCTTTACCGAGTCTCTGACCAGTGGTGCCTCACTGCTAACTCTC
NM_001165412.1      TCCTTCCGCAAACTCAGCTTTACCGAGTCTCTGACCAGTGGTGCCTCACTGCTAACTCTC
NM_003998.3         TCCTTCCGCAAACTCAGCTTTACCGAGTCTCTGACCAGTGGTGCCTCACTGCTAACTCTC
XM_005263029.1      TCCTTCCGCAAACTCAGCTTTACCGAGTCTCTGACCAGTGGTGCCTCACTGCTAACTCTC
                    ************************************************************

HsCD00514661        AACAAAATGCCCCATGATTATGGGCAGGAAGGACCTCTAGAAGGCAAAATT---
NM_001165412.1      AACAAAATGCCCCATGATTATGGGCAGGAAGGACCTCTAGAAGGCAAAATTTAG
NM_003998.3         AACAAAATGCCCCATGATTATGGGCAGGAAGGACCTCTAGAAGGCAAAATTTAG
XM_005263029.1      AACAAAATGCCCCATGATTATGGGCAGGAAGGACCTCTAGAAGGCAAAATTTAG
                    ***************************************************   

Pathways

NCI : Alternative NF-kappaB pathway
NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Atypical NF-kappaB pathway
NCI : BCR signaling pathway
NCI : CD40/CD40L signaling
NCI : Canonical NF-kappaB pathway
NCI : Ceramide signaling pathway
NCI : EPO signaling pathway
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : Glucocorticoid receptor regulatory network
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : IL1-mediated signaling events
NCI : IL12-mediated signaling events
NCI : IL2 signaling events mediated by PI3K
NCI : IL23-mediated signaling events
NCI : LPA receptor mediated events
NCI : Osteopontin-mediated events
NCI : Regulation of Telomerase
NCI : Signaling events mediated by HDAC Class I
NCI : TNF receptor signaling pathway
NCI : amb2 Integrin signaling
Panther : Apoptosis signaling pathway
Panther : T cell activation
Reactome : Activated TLR4 signalling
Reactome : Activation of NF-kappaB in B cells
Reactome : Adaptive Immune System
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Cytokine Signaling in Immune system
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DEx/H-box helicases activate type I IFN and inflammatory cytokines production
Reactome : Developmental Biology
Reactome : Downstream TCR signaling
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : FCERI mediated NF-kB activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 processing
Reactome : Interleukin-1 signaling
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NF-kB is activated and signals survival
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : RIP-mediated NFkB activation via ZBP1
Reactome : Regulated proteolysis of p75NTR
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Signal Transduction
Reactome : Signaling by Interleukins
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TCR signaling
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated NF-kB activation
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : Transcriptional regulation of white adipocyte differentiation
Reactome : ZBP1(DAI) mediated induction of type I IFNs
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR signals via NF-kB
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : Apoptosis Modulation by HSP70
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EBV LMP1 signaling
WikiPathway : Estrogen signaling pathway
WikiPathway : Folate Metabolism
WikiPathway : IL-1 signaling pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Leptin signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : Neural Crest Differentiation
WikiPathway : Notch Signaling Pathway
WikiPathway : Osteopontin Signaling
WikiPathway : Oxidative Stress
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : SIDS Susceptibility Pathways
WikiPathway : Selenium Metabolism and Selenoproteins
WikiPathway : Selenium Pathway
WikiPathway : TCR Signaling Pathway
WikiPathway : TFs Regulate miRNAs related to cardiac hypertrophy
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : Vitamin B12 Metabolism

Clone

Cloning Information : 605805
Original Clone ID : ccsbBroadEn_06637

Organism


TAX_ID : 9606
Species Specific ID: 4790

Genome

Chromosome : 4
Map Location : 4q24
Ensembl : ENSG00000109320

Reagents

Labome : p50-antibody